ID: 1152078805

View in Genome Browser
Species Human (GRCh38)
Location 17:78174148-78174170
Sequence GGGGCTTATCTCTTCAAGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152078805_1152078812 3 Left 1152078805 17:78174148-78174170 CCACACTTGAAGAGATAAGCCCC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1152078812 17:78174174-78174196 GATCCAAGTCCCAGCAAGGTTGG 0: 1
1: 0
2: 5
3: 45
4: 349
1152078805_1152078811 -1 Left 1152078805 17:78174148-78174170 CCACACTTGAAGAGATAAGCCCC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1152078811 17:78174170-78174192 CTGGGATCCAAGTCCCAGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 854
1152078805_1152078816 18 Left 1152078805 17:78174148-78174170 CCACACTTGAAGAGATAAGCCCC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1152078816 17:78174189-78174211 AAGGTTGGTGCCACCCATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152078805 Original CRISPR GGGGCTTATCTCTTCAAGTG TGG (reversed) Exonic
903867369 1:26409593-26409615 GGAGGTTACCTCTTCAAATGAGG + Intergenic
904830923 1:33306479-33306501 GGGATTTTTCTCTTGAAGTGAGG + Intergenic
912580842 1:110719557-110719579 GGATCTTATCTCTTCAACAGTGG + Intergenic
912612722 1:111064963-111064985 TGGGCATAACTCCTCAAGTGTGG - Intergenic
913010202 1:114675781-114675803 GGTGCTTATCTCTTTATGTTTGG - Intronic
919193512 1:194253583-194253605 GGGACTAATCTCTTAAACTGTGG + Intergenic
924240900 1:242039309-242039331 GGGGCGGATCTCTTGAAGTCAGG + Intergenic
1063607291 10:7533854-7533876 GGGGCTCATCTCATCAGTTGAGG - Intergenic
1065198358 10:23288693-23288715 GTGGCTAAGCTCTTCAAATGTGG + Intronic
1068954718 10:62812778-62812800 GATGCTGATCCCTTCAAGTGGGG - Exonic
1070352684 10:75608749-75608771 GGGGCATAACCCTTTAAGTGAGG + Intronic
1070630725 10:78082579-78082601 AGGGCCTATCTCTGCCAGTGTGG - Intergenic
1071727443 10:88213648-88213670 TGGCCGTATCTCTTCAACTGGGG - Intergenic
1073066917 10:100766554-100766576 GGGGCTTAACTCTCCAAATCAGG + Intronic
1073230117 10:101962223-101962245 GGGCATTATCTCTTCAGGTTTGG - Intronic
1084217658 11:67658937-67658959 GGGTTTTTTCTCTTCATGTGTGG + Intergenic
1085712996 11:78847057-78847079 GGGGCTTATGTCTGCATGTCAGG - Intronic
1098980373 12:76949652-76949674 AGGGCTTATCTCTACAAGAGGGG + Intergenic
1099456749 12:82872263-82872285 GGGGCATATCATTTCAACTGTGG + Intronic
1099477722 12:83127844-83127866 TTGGCTTATTTCTTCAACTGTGG - Intronic
1100400530 12:94225399-94225421 GGGCCTCATCTCTTCCACTGAGG + Intronic
1102398119 12:112605028-112605050 GGGCTTTACCTCTTGAAGTGGGG + Intronic
1104862879 12:131933763-131933785 GTGGGTTTTCTCTTCATGTGCGG + Intronic
1113104401 13:106757714-106757736 AGGGCTTCTCTCTCCAAGTGTGG - Intergenic
1116865702 14:50029853-50029875 GTGGCCTCTCTCCTCAAGTGTGG + Intergenic
1118157416 14:63255419-63255441 GAGCCTTGTCTCTTGAAGTGGGG + Intronic
1119177439 14:72579547-72579569 GGGGCATCTCTCTTGGAGTGAGG + Intergenic
1126768327 15:52031158-52031180 TGGGCGGATCACTTCAAGTGAGG - Intronic
1137017296 16:35390937-35390959 TGGGCTTTTCTCTTCCTGTGCGG + Intergenic
1140429868 16:74893234-74893256 GGGGCTGACCTCATCAGGTGAGG + Intronic
1143893994 17:10122602-10122624 GGGGCTTTTCACCACAAGTGGGG - Intronic
1147838278 17:43350784-43350806 GTGGGTTTTCTCTTCATGTGTGG + Intergenic
1152078805 17:78174148-78174170 GGGGCTTATCTCTTCAAGTGTGG - Exonic
1153131607 18:1860229-1860251 AGGGTTTATCTCCTCAAATGTGG + Intergenic
1157282347 18:46354287-46354309 TGGGCTCAGCTCTACAAGTGTGG + Intronic
1158622558 18:59045589-59045611 GGGGCATATCACTTGAGGTGAGG + Intergenic
1165136572 19:33673531-33673553 GGGGCTTTTGTCTTCAAGTGTGG + Intronic
1166147445 19:40847371-40847393 GGTGTTTAGCTCTTCAGGTGGGG + Intronic
1166151594 19:40879256-40879278 GGTGTTTAGCTCTTCAGGTGGGG + Intronic
1166178590 19:41091389-41091411 GGTGTTTAGCTCTTCAGGTGGGG - Intronic
1168574483 19:57498766-57498788 GGGGCTTCTTGCTTCTAGTGAGG - Intronic
930125769 2:47795138-47795160 AGGGCATACCTCTTCAAGTGAGG - Intronic
931701954 2:64916624-64916646 GGGCCTCACCTCTCCAAGTGTGG + Intergenic
937774368 2:125758309-125758331 ATGGCTTATGTCTTCCAGTGGGG - Intergenic
938697529 2:133848255-133848277 GGGGCTTGTCTCTTCTCGTAGGG - Intergenic
941644704 2:168027398-168027420 GGGGCATATTTCTGCACGTGTGG - Intronic
942886905 2:180937021-180937043 GGGGCTTATTTCTTCATATTAGG - Intergenic
947294751 2:228618028-228618050 GGGGCTGAGCTCTTCACTTGTGG + Intergenic
1172250553 20:33476176-33476198 GGGGCTTATTTATTTGAGTGGGG + Intergenic
1173646152 20:44634290-44634312 GGAGCTTATATCTCTAAGTGGGG - Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177897463 21:26871718-26871740 TGGGTTTTTCTCTTCATGTGCGG + Intergenic
1178197661 21:30367020-30367042 GAGGCTCATAACTTCAAGTGTGG - Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1182837101 22:33350953-33350975 GGGGCTTCTCTCTTCAATTTGGG + Intronic
959149173 3:102588057-102588079 GGGCCTAATCTATTCAAATGAGG - Intergenic
962390817 3:134971153-134971175 GAGGCTTAACTTATCAAGTGTGG + Intronic
964728092 3:159836096-159836118 GGGGTTTATTTCTCCAAGTCTGG + Intronic
968028163 3:195460533-195460555 GGAGCTTATCTTTTCTAGTAAGG - Intergenic
968028169 3:195460564-195460586 GGAGCTTATCTTTTCTAGTAAGG - Intergenic
969706580 4:8795496-8795518 CGGGATTATCTCTTCATTTGGGG - Intergenic
971561330 4:28082773-28082795 TTGGCTTTTCTCTTCCAGTGTGG - Intergenic
980950776 4:139373930-139373952 TGGGCATATCACTTCAAGTCAGG - Intronic
986926356 5:12757667-12757689 GGGGCTTTTCTCTTCTTTTGTGG + Intergenic
991926222 5:71707562-71707584 GGGGCTTATCTCTGCATGCCAGG + Intergenic
993035145 5:82748085-82748107 GGGGCAGGTCTCTTCAACTGAGG + Intergenic
995438849 5:112167533-112167555 GGGGGATTTCTCTTCAACTGAGG - Intronic
996184314 5:120457787-120457809 TGGGTTTTTCTCTTCATGTGCGG + Intergenic
996361224 5:122649398-122649420 TGGGCTTATCTCTTGAGGTCAGG + Intergenic
996898865 5:128520492-128520514 GGGGCCAAACACTTCAAGTGAGG + Intronic
1007604260 6:43105649-43105671 GGGCCTTTTCTCTTCACATGGGG - Intronic
1016423867 6:143913460-143913482 GGGTCTTATCTTGTCAGGTGTGG + Intronic
1019189006 6:170239109-170239131 GGAGCTTCTCTCTTCCACTGTGG - Intergenic
1020872593 7:13650494-13650516 CAGGATTATCTGTTCAAGTGAGG + Intergenic
1032846984 7:135759448-135759470 TGGGCTTCCGTCTTCAAGTGTGG - Intergenic
1037480080 8:19296736-19296758 GGGGCATATCTCTACAGGGGAGG + Intergenic
1043813126 8:84767581-84767603 GGCCCTTCTCCCTTCAAGTGGGG + Intronic
1044637856 8:94344666-94344688 GGAACTTATCTCTCCAACTGTGG + Intergenic
1047145902 8:122199083-122199105 TGGGCTAATCACTTGAAGTGGGG - Intergenic
1050016266 9:1237321-1237343 GTGGTTTCTCTCTTCCAGTGTGG + Intergenic
1052031579 9:23635291-23635313 AGGGTTTTTCTCTTTAAGTGTGG + Intergenic
1060589688 9:124808926-124808948 TGGGCTGATCACTTCAAGTCAGG + Intronic
1187427613 X:19192709-19192731 AGTGGTTATCTCTTCCAGTGGGG - Intergenic
1188735595 X:33710613-33710635 AGGGCATTTCTCTTCAACTGAGG + Intergenic
1189319236 X:40077647-40077669 GGGGCTAATCTTTTAAAGGGCGG + Intronic
1189356826 X:40316225-40316247 GGGGATCATATCTGCAAGTGAGG + Intergenic
1189389065 X:40560703-40560725 GGGGCTTATAGATTTAAGTGAGG + Intergenic
1189630523 X:42947779-42947801 TGGGGTTATCTCTTCCAGTTTGG - Intergenic
1191749199 X:64522999-64523021 GAGTATTGTCTCTTCAAGTGTGG + Intergenic
1196481354 X:116153575-116153597 GGGACTTATCTTTTGAAGTCTGG + Intergenic
1199534490 X:148886730-148886752 TGTGCTTATCACCTCAAGTGAGG + Intronic