ID: 1152079588

View in Genome Browser
Species Human (GRCh38)
Location 17:78178435-78178457
Sequence CCTTCCTCAGGATGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152079577_1152079588 29 Left 1152079577 17:78178383-78178405 CCTGTGTGTCTCGCCCGGGGTAC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG 0: 1
1: 0
2: 0
3: 20
4: 166
1152079578_1152079588 16 Left 1152079578 17:78178396-78178418 CCCGGGGTACAAAGAAGCACAGA 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG 0: 1
1: 0
2: 0
3: 20
4: 166
1152079579_1152079588 15 Left 1152079579 17:78178397-78178419 CCGGGGTACAAAGAAGCACAGAA 0: 1
1: 0
2: 1
3: 26
4: 205
Right 1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG 0: 1
1: 0
2: 0
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152079588 Original CRISPR CCTTCCTCAGGATGGCACGG TGG Intronic
903826233 1:26147519-26147541 CTTTGTTCAGGCTGGCACGGTGG - Intergenic
904860889 1:33536922-33536944 CCTTCCTCAGGACAGCACTCAGG - Intronic
905337544 1:37255938-37255960 TTATCCTCAGGATGGCACAGAGG + Intergenic
905454057 1:38075515-38075537 CCTTCCTCACCATGGCCCAGGGG + Intergenic
905815889 1:40950574-40950596 CCTTCCTCAGCCAGGCACAGTGG - Intergenic
906276384 1:44519469-44519491 CATTCCTCAGGATGCAACTGGGG - Intronic
908504712 1:64785078-64785100 CCTTCCTTAGCATGGCATGCAGG + Intronic
909680352 1:78284956-78284978 CCTTCCTCAGGATGCCAGGCTGG + Intergenic
912381412 1:109249925-109249947 CCTGCGTCTGGATGGCTCGGCGG - Intergenic
917457795 1:175200477-175200499 CCTTCCTCAGTATGGCTCTGGGG + Intergenic
917731076 1:177875666-177875688 CCTTCAGCAGGGTGGCACTGGGG - Intergenic
918447689 1:184631204-184631226 CCTTCCTCAGCATGGCAACTTGG - Intergenic
919790892 1:201290318-201290340 GCTTCCTGAGGATGGCACACAGG + Intronic
919945348 1:202315188-202315210 CATTGCTCAGGGTGGCACGTGGG + Intronic
920317198 1:205085243-205085265 CCTTCCTCAGATAGGCAAGGAGG - Intergenic
920696263 1:208183378-208183400 CCTTCCTCAGCAGGGGATGGGGG + Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
923596705 1:235365872-235365894 CTCTCCTCAGCAGGGCACGGTGG - Intergenic
1066262138 10:33739274-33739296 CTTTCCTCATGATGCCAAGGTGG + Intergenic
1066641406 10:37557852-37557874 CCTTCCTCAAGATGGCTCCAAGG - Intergenic
1067820839 10:49528754-49528776 CCGTCCTCAGGAGAGCATGGGGG - Intronic
1074340926 10:112629202-112629224 CCTGCCTCAGGATAGCACTCTGG + Intronic
1075414069 10:122249598-122249620 CCTTCCGCAGGCTGGCCTGGTGG - Exonic
1076976953 11:180235-180257 ACTTCCTCAGGGCAGCACGGGGG - Intronic
1077380911 11:2236959-2236981 CCTTCCCCAGGATGTCACACTGG + Intergenic
1077401113 11:2357933-2357955 CCTTCCCCAGGATGTCACACTGG + Intergenic
1081980885 11:47266316-47266338 CCTTTTTCAGCAGGGCACGGTGG - Intronic
1083162495 11:60863480-60863502 TCTTCTTCTGGCTGGCACGGTGG - Intergenic
1083258886 11:61512658-61512680 AGTGCCTCAGGATGGCCCGGGGG - Intergenic
1089675528 11:120086097-120086119 CCTTCTTCATTTTGGCACGGTGG - Intergenic
1090071520 11:123548473-123548495 CTTTCCATAGGATGGCATGGAGG - Intronic
1090071742 11:123550071-123550093 CTTTCCATAGGATGGCACGGAGG - Intronic
1090627706 11:128620434-128620456 ACATCCTCAGGATAGCACAGGGG - Intergenic
1095951333 12:47783534-47783556 CATTCCTCAGGACTGCACAGAGG - Exonic
1101888421 12:108689646-108689668 CCTTCCCCAGGATGGGGTGGGGG - Intronic
1102881541 12:116488872-116488894 CCTACCTCAGCATGGGACTGAGG - Intergenic
1103478797 12:121237600-121237622 CCTTCCTCAGGCTGACAGCGAGG - Intergenic
1104742786 12:131190710-131190732 TCTTCCTCTGGATGGCAAGCAGG + Intergenic
1105918815 13:24941607-24941629 TCTTCCCCAGTGTGGCACGGGGG - Intergenic
1105950159 13:25223095-25223117 ACCTCCTCACGATGGCCCGGAGG - Intergenic
1114266565 14:21075686-21075708 GGCTCCTCAGGAGGGCACGGTGG - Exonic
1115959416 14:38818962-38818984 CATTCCTCAGGGTGGCCAGGAGG - Intergenic
1117860898 14:60091870-60091892 CCTTCCTCAGGATTGTGCGCCGG - Intergenic
1118375587 14:65174332-65174354 ACTCCCTCAGGATGTCACAGAGG + Intergenic
1118819322 14:69334766-69334788 CCTTCCTCAGGCAGACAGGGAGG - Intronic
1120381351 14:83784006-83784028 CTTACCTCAGGAGGGCAGGGAGG + Intergenic
1121250019 14:92492569-92492591 CATCCCTCAGGATGGCACGTCGG + Intronic
1126450060 15:48797470-48797492 CCTTCTTCAGGATGGTACACAGG + Exonic
1127906390 15:63379509-63379531 GCTCCCTCAGGATGCCACTGAGG - Intronic
1129325796 15:74799678-74799700 CCCTCCTCATGGTGGCACTGTGG - Intronic
1129625641 15:77195836-77195858 GCTTCCTCAGGATGGAGCGTCGG - Intronic
1129744505 15:78008481-78008503 ACTTCCTCAGGACTGCATGGTGG + Intronic
1131486816 15:92827781-92827803 CCTTCCTCAGCCGGGCATGGTGG - Intergenic
1132136405 15:99344565-99344587 CCTTCCTCAGAATAGCCAGGAGG + Intronic
1133022688 16:2973874-2973896 CCTTCCCCAGGATGTGATGGGGG + Intronic
1136618610 16:31413295-31413317 CCATCCTCAGGATGGCATTGGGG - Intronic
1137876167 16:51998589-51998611 CCTACCTCAGGAGGGCAGGCAGG - Intergenic
1139915090 16:70423175-70423197 CCTTCCTCTTAATGGCCCGGGGG - Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1142367043 16:89656091-89656113 CCTTCATGATGATGACACGGTGG + Intronic
1142443307 16:90116435-90116457 ACTTCCTCAGGGCAGCACGGGGG + Intergenic
1142464091 17:118409-118431 ACTTCCTCAGGGCAGCACGGGGG - Intergenic
1142894587 17:2965626-2965648 CCTACCTAAGGATGACCCGGAGG - Exonic
1143713925 17:8753622-8753644 CCTTCCTCAGGAGGCCCCGCTGG + Intronic
1144779185 17:17799409-17799431 CCTCCCTCAGAAGGGCACAGAGG - Intronic
1148465960 17:47865484-47865506 CCTTCCCCAGGGTGGCTTGGAGG - Intergenic
1150427844 17:65091037-65091059 CATTCCTTAGGATGGAAAGGAGG + Intergenic
1151470794 17:74316525-74316547 CGTTCCTGAGGACGGCACTGAGG - Intergenic
1151946339 17:77321944-77321966 CCTTCGTCAGGCTTGCACAGTGG + Intronic
1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG + Intronic
1152378513 17:79930519-79930541 CCTTCATCAGGACCGCACGAAGG + Intergenic
1152715884 17:81900477-81900499 CCTCCCTCAGGCTGGCTCTGAGG + Intronic
1153261231 18:3226370-3226392 GCCTCCTCAGCATGGCACGAGGG + Intergenic
1153286235 18:3457400-3457422 CCTTTCTCAGCATGTCAGGGAGG - Exonic
1156831786 18:41500522-41500544 CCTTCCTCAGGATGTGGGGGTGG + Intergenic
1157825468 18:50808308-50808330 CCTTTCTAAGGATGGTAGGGAGG - Intronic
1158923366 18:62221080-62221102 CCTTTGTCAGGTTGGCTCGGAGG - Exonic
1160841253 19:1147889-1147911 CCATCCTCAGGGTGACAGGGCGG - Intronic
1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG + Intronic
1164147535 19:22521254-22521276 CTTTCCTCAGGATGCCCCTGAGG - Intronic
1164159068 19:22614859-22614881 CTTTCCTCAGGATGCCCCTGAGG + Intergenic
1165871639 19:38976753-38976775 CCGTCCTCACGATGGCGCTGTGG - Intergenic
1167002656 19:46755402-46755424 CCTCCCCCAGGATGCCCCGGAGG + Exonic
927127240 2:20022976-20022998 CTTTCCCCAGGATGGTACAGGGG - Intergenic
927610030 2:24529171-24529193 TCTTCATCAGGCCGGCACGGTGG - Intronic
932750847 2:74370813-74370835 TCTTCCTCAGGAAGCCAAGGAGG - Exonic
932895797 2:75638196-75638218 GCTTCTTCAGGAGGGCACTGAGG - Intergenic
934941340 2:98504893-98504915 CCTTCAGCAGGATGGCACGTGGG - Intronic
935707619 2:105870366-105870388 ACTGCCACAGGATGGCAGGGAGG - Intronic
936457865 2:112689040-112689062 TCTTCATCAGGAGGGCACAGCGG - Intergenic
937845927 2:126578893-126578915 CTGTCCTAAGGATGGCACTGAGG + Intergenic
939950100 2:148460579-148460601 CCTGCCTCAGGGTGGCATTGAGG + Intronic
947289357 2:228554858-228554880 CCTTCCTCAGGGTGGGAAGTGGG - Intergenic
1172209624 20:33187517-33187539 GCTCCCACAGGATGGTACGGGGG + Intergenic
1172777849 20:37417631-37417653 CTTCCCTCAGGAAGCCACGGTGG - Intergenic
1173875432 20:46367518-46367540 CCTTCCCCAGAAGGGCACTGAGG + Exonic
1174368836 20:50072829-50072851 CCTTCGGCAGGCGGGCACGGTGG - Intergenic
1175947927 20:62567311-62567333 CCGTCCTGGGGATGGCAAGGCGG - Intronic
1182894560 22:33848553-33848575 CCTTACTCAGGAAGGGAAGGAGG + Intronic
1183302212 22:37063906-37063928 CCTTCCACAGGCTGGGGCGGGGG + Intergenic
1184656448 22:45944317-45944339 CCTTCCTGGGGGTGGCATGGAGG - Intronic
1185010360 22:48309412-48309434 CCGTCCTCAGGAAGGCCTGGAGG + Intergenic
949563036 3:5220449-5220471 CCTTCCTCAGGATCCCACCATGG - Intergenic
950187087 3:10951914-10951936 TCTTCCTCAGGATGGAATGTCGG - Intergenic
950644367 3:14368302-14368324 CCTGCCCCAGGATGGCACCGGGG - Intergenic
950660006 3:14461418-14461440 GCATCCTCAGGCTGGCACGGGGG - Intronic
950869921 3:16219671-16219693 CCTTCCTCAGACTGGCATGGAGG - Intronic
950917854 3:16664010-16664032 CCTTCCTCAGGAGGACAAAGTGG + Intronic
952330764 3:32362622-32362644 TCCTGCTCAGGATGGCACAGTGG - Intronic
952505110 3:34000056-34000078 CCTTCTCCAGAATGGCACAGTGG + Intergenic
953136140 3:40183294-40183316 CCTTCCTCAGGATGTCCCTCAGG - Intronic
954652668 3:52174931-52174953 CCTTCCTCATCATGGCACACTGG + Intergenic
955023630 3:55145650-55145672 GCTTCCAGAGCATGGCACGGAGG + Intergenic
955768383 3:62368069-62368091 GCTTCCTCAGGCTGTCGCGGGGG - Intergenic
961442365 3:126960616-126960638 CCTTTCTAGGGATGGCACAGAGG + Intergenic
962632683 3:137295577-137295599 CCTTCCTCAGCAGGGCAGTGTGG + Intergenic
962706905 3:138052371-138052393 CCTTCCACACGGTGGCACTGTGG - Intergenic
963135604 3:141900720-141900742 CCTTCCCCTGGATGACATGGTGG + Intronic
966496303 3:180585512-180585534 CCTCTATCAGGATGGCATGGTGG - Intergenic
966940053 3:184740612-184740634 CCTTCTCCAGGATGGCAAAGCGG - Intergenic
967231059 3:187337822-187337844 CATTCCTCATGTTGGCACTGAGG - Intergenic
968646731 4:1744766-1744788 CCTTCCTCAGGCTGGCCTGGAGG - Exonic
969319817 4:6404909-6404931 CCTTGCTCAAGATGGCACAGTGG - Intronic
971029278 4:22619601-22619623 CCTTCCTCAGCCAGGCACAGTGG - Intergenic
975212915 4:71722115-71722137 CCTTCCTCAGGAGGCCCTGGGGG + Intergenic
975437814 4:74374361-74374383 GCTTCCTAAGGATTGCACTGAGG - Intronic
985290698 4:188384260-188384282 CCTTCCTCAGGATGACATTCAGG + Intergenic
986221423 5:5772077-5772099 CTTTCCTCATGATAGCAAGGTGG - Intergenic
986264437 5:6180597-6180619 CCTCCCTCAGGATGGAGGGGAGG - Intergenic
986264485 5:6180774-6180796 CCTCCCTCAGGATGGAGGGGAGG - Intergenic
986264509 5:6180843-6180865 CCTCCCTCAGGATGGAGGGGAGG - Intergenic
986264553 5:6181029-6181051 CCTCCCTCAGGATGGAGGGGAGG - Intergenic
986264584 5:6181151-6181173 CCTTCCTCAGGATGGAGGTGAGG - Intergenic
986264615 5:6181274-6181296 CCTCCCTCAGGATGGAGGGGAGG - Intergenic
990334785 5:54761893-54761915 CCTTCCTGTGGATGGGATGGGGG - Intergenic
995481395 5:112596872-112596894 CCTTCCACAGGATGGGACAGGGG - Intergenic
996854236 5:127987231-127987253 CCTTCCTCGGGATGTCCCAGAGG + Intergenic
997165825 5:131659583-131659605 CCAGACACAGGATGGCACGGGGG + Intronic
997589376 5:135063555-135063577 GCTTCCTCAAGATGTCAGGGAGG + Intronic
997853306 5:137351903-137351925 CCTTGCTCTAGATGGCACAGTGG + Intronic
999327735 5:150653556-150653578 CCCTGCTCAGGGTGGCACTGTGG + Exonic
1001050308 5:168408682-168408704 CCTTCCACAGGATGGCAGCTGGG + Intronic
1007536490 6:42595456-42595478 CCTTCCTCAGCCAGGCAAGGTGG + Intronic
1010088699 6:71952822-71952844 GCTTCCTCAGGTTGGCTGGGTGG + Intronic
1015275913 6:131383316-131383338 CCATTCTCAGGAAGGCACAGAGG - Intergenic
1016483756 6:144511850-144511872 CCTTCCTCAGCAGGGGAGGGTGG - Intronic
1017300946 6:152856850-152856872 CCTTCCTCAGGCTTGCACGCTGG - Intergenic
1018982517 6:168611852-168611874 GCTTCCTCAGGATGCCCAGGCGG + Intronic
1019252077 7:20860-20882 ACTTCCTCAGGGCAGCACGGGGG - Intergenic
1019299347 7:295673-295695 ACTTCCTCAGGATGGCACCTGGG + Intergenic
1019668752 7:2266806-2266828 TCTTCTTCAGGCTGGCGCGGTGG - Intronic
1019937413 7:4265398-4265420 CCTCCCTCAGGGCGGAACGGAGG + Exonic
1029387783 7:100255169-100255191 CCTTCCTTAGGATGGCCTGAGGG - Intronic
1029662213 7:101970344-101970366 CCTTCCTTAGCTTGGCCCGGGGG + Intronic
1030069886 7:105689381-105689403 CTTTCCCAAGGATGGCAGGGTGG + Intronic
1031999868 7:128257879-128257901 CATTCCTTGGGATGGCACAGAGG - Intergenic
1032013657 7:128362025-128362047 CCTGCCCCAGGATGGCACCCCGG + Intergenic
1032653275 7:133901818-133901840 CCTTCCTCATGTTGGCATGCAGG + Intronic
1034510907 7:151533866-151533888 CCTGTCTCAGCCTGGCACGGTGG - Intergenic
1034535671 7:151724433-151724455 CCTTCCTCAGGAGGGGAGGACGG - Intronic
1035390048 7:158497622-158497644 CCATCCTGAGGACTGCACGGTGG + Intronic
1042666319 8:71210468-71210490 CCTTCCTTAGCCTGGCACTGAGG - Intronic
1043034281 8:75177569-75177591 CCTGCCTCAGGCTGGCAATGGGG - Intergenic
1044672110 8:94692737-94692759 CCCTCCACAGCCTGGCACGGTGG + Exonic
1046222937 8:111238998-111239020 CTTTCCTCAGGAGGGGAGGGCGG + Intergenic
1046723064 8:117643070-117643092 CCTTCCCCAGGATGGAACGTAGG + Intergenic
1046952161 8:120029310-120029332 CCTTCCTCAGGATAGTATGAAGG - Intronic
1047330834 8:123885278-123885300 CATTCCTCAGCATGGCAAGAGGG - Intronic
1048500952 8:134974604-134974626 CCATTCCCAGGATGGCACAGAGG + Intergenic
1049272674 8:141704266-141704288 GCTTCATCAGGATGGCGCTGAGG + Intergenic
1049662263 8:143824745-143824767 GCTGCCTCAGGAGGGCATGGGGG - Intronic
1055554057 9:77458178-77458200 CTTTCCTCTAGATGGCACTGTGG + Intronic
1060530007 9:124342485-124342507 CCTTCCTCACTATGACAAGGTGG - Intronic
1062069804 9:134549571-134549593 CCAGCCTCAGGCTGGCACAGAGG - Intergenic
1062165304 9:135104659-135104681 CCAGCCTCTGGATGGCAGGGAGG + Intronic
1062282527 9:135758422-135758444 GTGTCCGCAGGATGGCACGGTGG - Exonic
1062748264 9:138231055-138231077 ACTTCCTCAGGGCAGCACGGGGG + Intergenic
1186221243 X:7351505-7351527 CTTTCCTCAGGATGGGCTGGTGG - Exonic
1191103878 X:56760279-56760301 CCTTCCACTGGATGTCACTGTGG + Intergenic
1191105266 X:56768488-56768510 CCTTCCGCTGGATGGCACTGTGG + Intergenic
1191106259 X:56773890-56773912 CCTTCCGCTGGATGGCACTGTGG + Intergenic
1191107252 X:56779292-56779314 CCTTCCGCTGGATGGCACTGTGG + Intergenic
1191107934 X:56783725-56783747 CCTTCCGCTGGATGGCACTGTGG + Intergenic
1191108770 X:56789024-56789046 TCTTCCTCTGGGTGGCACTGTGG + Intergenic
1194986190 X:100492202-100492224 CCTTCCTCAAGATGGCATCAGGG + Intergenic
1198253718 X:134906939-134906961 CCTGCCTCGGCCTGGCACGGTGG + Intronic
1202034824 Y:20621407-20621429 GCTTCCTGATGATGGCAGGGTGG - Intergenic