ID: 1152080392

View in Genome Browser
Species Human (GRCh38)
Location 17:78183820-78183842
Sequence CTCTGTTTAGGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 421}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152080392_1152080399 -7 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080399 17:78183836-78183858 AACAGAGAAAGACAAAGTGAGGG 0: 1
1: 0
2: 16
3: 161
4: 1630
1152080392_1152080401 0 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080401 17:78183843-78183865 AAAGACAAAGTGAGGGCAGGTGG 0: 1
1: 0
2: 9
3: 63
4: 721
1152080392_1152080406 26 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080406 17:78183869-78183891 GCCAGCTGTGGCCCCTGCAAGGG 0: 1
1: 0
2: 1
3: 37
4: 267
1152080392_1152080404 14 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080404 17:78183857-78183879 GGCAGGTGGGAGGCCAGCTGTGG 0: 1
1: 0
2: 4
3: 108
4: 714
1152080392_1152080402 1 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080402 17:78183844-78183866 AAGACAAAGTGAGGGCAGGTGGG 0: 1
1: 0
2: 5
3: 47
4: 404
1152080392_1152080403 4 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080403 17:78183847-78183869 ACAAAGTGAGGGCAGGTGGGAGG 0: 1
1: 0
2: 2
3: 38
4: 546
1152080392_1152080405 25 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080405 17:78183868-78183890 GGCCAGCTGTGGCCCCTGCAAGG 0: 1
1: 0
2: 3
3: 43
4: 383
1152080392_1152080400 -3 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080400 17:78183840-78183862 GAGAAAGACAAAGTGAGGGCAGG 0: 1
1: 0
2: 8
3: 94
4: 1202
1152080392_1152080398 -8 Left 1152080392 17:78183820-78183842 CCCTCTTCCCTCCCTAAACAGAG 0: 1
1: 0
2: 3
3: 37
4: 421
Right 1152080398 17:78183835-78183857 AAACAGAGAAAGACAAAGTGAGG 0: 1
1: 0
2: 12
3: 174
4: 1974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152080392 Original CRISPR CTCTGTTTAGGGAGGGAAGA GGG (reversed) Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901408916 1:9069376-9069398 CTCTGTGTTGGGAGGGATTATGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903750711 1:25618505-25618527 AACTGTGTAGGGAGGAAAGAAGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
907813372 1:57894384-57894406 CTCATTTTAGGTAGGGAAGTTGG + Intronic
907940300 1:59081236-59081258 CTTTTTTTTGGAAGGGAAGATGG + Intergenic
908115736 1:60938233-60938255 CTCTTTTTTGGAAGGGAGGAGGG + Intronic
908365145 1:63414653-63414675 CTCTGTTCAAGGAGAGAACAAGG - Intronic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
910131378 1:83911020-83911042 GTCTGGTTAGGGAAGGAAGTGGG + Intronic
910384299 1:86664758-86664780 CTCTCTTTGAGGAGAGAAGAGGG + Intergenic
910419311 1:87040273-87040295 CTCTGTTCAGGGAGCGGGGAGGG - Intronic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
913018579 1:114764227-114764249 CTCTGCTAGGGGAGTGAAGAAGG + Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913314906 1:117541316-117541338 CTCTGTTTGTGGAGAAAAGAAGG + Intergenic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
914420231 1:147522245-147522267 CCCTTTTTTGGGAGGGAACATGG + Intergenic
914454273 1:147821094-147821116 CTCCCTTTAGGGTGTGAAGAAGG + Intergenic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
915804142 1:158827117-158827139 TTTTGTTTGGGGAGAGAAGAGGG + Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916157438 1:161867320-161867342 GTCTATTTAGGGAGGGAGGGAGG + Intronic
917470295 1:175320815-175320837 CCCTGTTTAATGAGGAAAGAAGG - Exonic
918684141 1:187394548-187394570 CTCTGTCTAGTGAGGGATGGTGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
922167869 1:223130687-223130709 CTCTGTTCAGATAAGGAAGAAGG - Intronic
922228668 1:223667155-223667177 CTCTTTTTTGGGAGGGATGGGGG - Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
922933491 1:229407673-229407695 GTCTGTGGAGGGAGGGAAGGAGG + Intergenic
923330934 1:232923977-232923999 GGCTGTAAAGGGAGGGAAGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924403325 1:243713648-243713670 GTCTGTTTAGGGGGGTAGGATGG - Intronic
924516440 1:244770089-244770111 TTCTGCTTAGCGAGGGATGAAGG - Intergenic
1063047340 10:2405764-2405786 AGCAGTTTAGGGAGGCAAGATGG + Intergenic
1063608350 10:7542214-7542236 CTCTGTTTTGGGAAGTAGGACGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1066448072 10:35502139-35502161 CTCTGCTCAAGGAAGGAAGAGGG - Intronic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068411427 10:56660630-56660652 CTCTGCTTGAGGAAGGAAGATGG - Intergenic
1068831584 10:61501775-61501797 CTCTTTTTGGGGAAGGATGATGG + Intergenic
1069545116 10:69322114-69322136 GTTTGTTTAGAAAGGGAAGATGG + Intronic
1069753375 10:70759183-70759205 CTTTGCTTTGGGAAGGAAGACGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069813434 10:71178990-71179012 GGCTGTCTAGGGAGGGAGGAGGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070261216 10:74857716-74857738 GTCTGTTTAGAAAGGAAAGAGGG + Intronic
1070312263 10:75282348-75282370 TTCAGTCCAGGGAGGGAAGAGGG - Intergenic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1071236753 10:83657900-83657922 CTCTGCTTAGGGAAAAAAGAGGG - Intergenic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1072225281 10:93363204-93363226 TTCTATTTAGGCAGGGAAAAAGG + Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073404733 10:103287248-103287270 GACTGGTGAGGGAGGGAAGAAGG + Intronic
1073436412 10:103519307-103519329 CTCTCTTTTGGGAGGGGACAGGG - Intronic
1074242153 10:111650219-111650241 CTCTGCTAAGGCAGGGCAGAAGG + Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074786792 10:116849051-116849073 CTCTGTTGGGGGAGGGATGTAGG - Intergenic
1074967374 10:118503308-118503330 CTCTGTTATGGGAGTCAAGAAGG - Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1076196032 10:128519011-128519033 CTCTGCTGAGGCAGGGAAGGAGG + Intergenic
1076345939 10:129779138-129779160 CCCTTTTTAGGAAGGGAGGAAGG - Intergenic
1076532101 10:131151735-131151757 CTCTGTTAGGGCAGTGAAGAAGG - Intronic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1078030542 11:7746660-7746682 CTCTACTGAGGGAAGGAAGAAGG + Intergenic
1078468491 11:11568497-11568519 CTCTGGTTAAGGGGGGAAAAAGG + Intronic
1081073768 11:38642758-38642780 CTCTGTTTAAGGAGACGAGAAGG - Intergenic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084292105 11:68179295-68179317 TTCTATTAAGGGAGGGAGGACGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1088801838 11:113314025-113314047 CTCTGTTTAGGCAGTGAGCAAGG + Intergenic
1089418918 11:118316325-118316347 CTCTCTTTAGAGAGGGCATAAGG + Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1092228486 12:6764272-6764294 CTCTCTTTAGGGCGGGGAGAAGG + Intronic
1093659447 12:21736989-21737011 CTCCGTTGAGGAAGGGAGGAAGG - Intronic
1093681657 12:22009773-22009795 CTCTGCTTAGGCAGTGCAGAAGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095324179 12:40867847-40867869 TTCTGTAAAGGGAGAGAAGATGG + Intronic
1095972479 12:47912079-47912101 CTCTGATTAGGGTGGAAGGAGGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1098117903 12:67199945-67199967 CTTAGTTAAGGGTGGGAAGAGGG - Intergenic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1102867670 12:116386909-116386931 CTCTCTCTAGGGTGGGAACAAGG - Intergenic
1102906135 12:116676503-116676525 CTTTTTTTTGGGAGGGAAGGGGG - Intergenic
1103217948 12:119217821-119217843 GTCTGGTAAGGGAGGGAAGTAGG - Intronic
1104212625 12:126704425-126704447 CTTTGTTTACATAGGGAAGAGGG - Intergenic
1104378346 12:128285134-128285156 CCCTGTTTAGTGAGGTAGGAGGG + Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1108492698 13:50997275-50997297 CACTCTTTAGGGAGAGAAAAGGG - Intergenic
1108739695 13:53322977-53322999 CTCTTTTCTGGGAGAGAAGAGGG + Intergenic
1109237411 13:59842121-59842143 CTGGGTTTAGGCAGGGAATATGG - Intronic
1109381412 13:61566301-61566323 CTCTGATTAGGGAGAGAACTTGG + Intergenic
1109594416 13:64531023-64531045 CTCTGTCTAGGCAGGGAGCAAGG + Intergenic
1111896627 13:94150163-94150185 ATTTGTGTAGGAAGGGAAGAGGG - Intronic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113233956 13:108248403-108248425 CTCTGTGGAGGGAGGGAGGGAGG + Intergenic
1113898251 13:113779465-113779487 CTCTGTTTTGGGGGCGTAGAGGG + Intronic
1114057603 14:18986378-18986400 TTCTGTTCAGGGAGGGAACCAGG + Intronic
1114104943 14:19415376-19415398 TTCTGTTCAGGGAGGGAACCAGG - Intronic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115490916 14:33957416-33957438 TACTGTTGAGGAAGGGAAGAAGG - Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1115925189 14:38425403-38425425 CTCTGCTTGAGGAGGGATGAAGG - Intergenic
1116583260 14:46669731-46669753 CTCTGTTGAGAGAGAGAGGAGGG - Intergenic
1116690764 14:48102810-48102832 GTCTGTTTTGGGGTGGAAGATGG - Intergenic
1118495711 14:66306335-66306357 CTCTGTGTAGGAAGGGACAAGGG + Intergenic
1118659380 14:67990917-67990939 TTCTTTTTAGAGAGGGTAGAAGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119716870 14:76865886-76865908 CTCTTTTGTGGGAGGGAAGGGGG + Intronic
1120443006 14:84562308-84562330 CTCTGGTTAGGAAAGGAAGTGGG + Intergenic
1120443269 14:84564148-84564170 CTCTGGTTAGGAAAGGAAGTGGG + Intergenic
1121234187 14:92380234-92380256 CTCTGTTTAATGAGGACAGAGGG - Intronic
1123152578 14:106197128-106197150 CTAGGTTTAGGAAGGGGAGAGGG + Intergenic
1123409200 15:20044552-20044574 ATCTGTTTAGGGGGTGAGGAAGG + Intergenic
1123497862 15:20847875-20847897 TTCTGTTCAGGGAGGGAACCAGG - Intronic
1123518531 15:21051260-21051282 ATCTGTTTAGGGGGTGAGGAAGG + Intergenic
1123555092 15:21421502-21421524 TTCTGTTCAGGGAGGGAACCAGG - Intronic
1123591338 15:21858834-21858856 TTCTGTTCAGGGAGGGAACCAGG - Intergenic
1123767954 15:23500559-23500581 CTCCTTTTAGGGAGAGAACAAGG + Intergenic
1123981556 15:25609322-25609344 CTCTGTTTGGGGAGAGGAAAAGG - Intergenic
1124570332 15:30857008-30857030 CTCCTTTTAGGGAGAGAACAAGG - Intergenic
1125173785 15:36796722-36796744 CTCTGTTTAGGGAGTTAAAAAGG - Intronic
1126667152 15:51085779-51085801 CTTTATTTAGGGAGAGAGGAGGG - Intronic
1126791143 15:52222389-52222411 CTCAGTTTAGGGAGAGGAGGGGG + Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1128908191 15:71487252-71487274 CTCTGTTTGGAGATGGAAGGTGG + Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1202963439 15_KI270727v1_random:148712-148734 TTCTGTTCAGGGAGGGAACCAGG - Intergenic
1132528013 16:426904-426926 CTCCTTTTAAGAAGGGAAGAGGG - Intronic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134294849 16:12936443-12936465 CTCAGTTCAGGGATGGGAGAAGG + Intronic
1134880638 16:17742783-17742805 CTTTCATTAGGGAGAGAAGAGGG - Intergenic
1136186541 16:28591819-28591841 CCCTGTTTGGAGAGGGGAGAGGG - Intergenic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1139004978 16:62559083-62559105 CTCTGCTTAAGGAGAGAAGAGGG - Intergenic
1139591841 16:67937323-67937345 CCCTCTTGAGAGAGGGAAGATGG - Intergenic
1140131289 16:72164165-72164187 CTCTGATTAGGGAGAAAGGAAGG + Intronic
1141453463 16:84121209-84121231 CACTGTTGAGGGCGGGATGATGG - Intergenic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141839407 16:86565345-86565367 GTCTGGTTGGGCAGGGAAGAGGG - Intergenic
1142410816 16:89915713-89915735 CTCTGCCTCGGGAAGGAAGACGG - Intronic
1144180338 17:12745715-12745737 CTTTGTTTAGGGAGATAAGAGGG - Intronic
1144783939 17:17821603-17821625 CTCAGTTTACAGGGGGAAGAGGG + Intronic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147256418 17:39184859-39184881 CTCTGTCTGGGGGGGGAAGCAGG + Exonic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148439370 17:47703636-47703658 TTCGGTTTAAGGAGGGAAGATGG - Intronic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1150491432 17:65577047-65577069 CGCTCTTTTGTGAGGGAAGATGG - Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152684856 17:81688928-81688950 CCCTGTGTTGGGAGGGAGGAGGG + Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153225387 18:2895830-2895852 GTATGTTTGGGGAGGGAAGGGGG + Intronic
1153864319 18:9249590-9249612 ATCTGTTGTGGGAAGGAAGACGG - Intronic
1154340355 18:13497718-13497740 CTCCCTTTGGGGAGGAAAGAAGG + Intronic
1155250810 18:23951599-23951621 CCCGGTTTGGGGAGGGAAGATGG + Intronic
1155377113 18:25172019-25172041 TTCTCTTTTGGGGGGGAAGAGGG + Intronic
1155970913 18:32082894-32082916 CCCTGTTTGGGGAGAGAGGATGG - Intergenic
1156022752 18:32618532-32618554 CTCTGTTCAGGGTAGTAAGAGGG + Intergenic
1156240419 18:35248335-35248357 CCATGTTTAGGGAGAGAATATGG + Exonic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157608239 18:48939662-48939684 CTCAGTTTAGGGTGGGAGGAAGG - Intronic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159446252 18:68544926-68544948 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1159521623 18:69532216-69532238 CTCTGTTCAGATAGGCAAGAGGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1166803987 19:45474010-45474032 CACTGTTGAGGGGAGGAAGAAGG - Exonic
1167707431 19:51089993-51090015 CATTGTTTCGGGAAGGAAGAAGG + Intergenic
1167884497 19:52489092-52489114 CTTTTTTTAGGGGGGGCAGACGG - Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
1168673118 19:58256441-58256463 CTAGGTTTAGGAAGGGGAGAGGG + Intronic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
925085527 2:1104917-1104939 TTCTTTTTAGGTAGGAAAGAAGG + Intronic
926344723 2:11934844-11934866 CTCTGAATTGGGAGGAAAGATGG + Intergenic
927370096 2:22344592-22344614 CTTTGTCTAGGAAAGGAAGATGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928175607 2:29032192-29032214 CCCTGTTTAGGGAGACATGAAGG - Intronic
928398343 2:30960255-30960277 CTCTAATCAGGGAGGGAAGCAGG + Intronic
929326414 2:40616750-40616772 ATCTGTTTGGGGAGATAAGAGGG - Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
930054918 2:47244428-47244450 CACTGATTGGGGAGGGAAGGGGG + Intergenic
930113530 2:47699126-47699148 CTCTGTCTAGGCAGTGAACAAGG + Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
932239840 2:70147965-70147987 CTATCTTTAAGGAGGAAAGAAGG - Intergenic
932382575 2:71298847-71298869 CCCTCCTTAGGGAGGGAGGAGGG - Intronic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
935163407 2:100548757-100548779 TTCAGTTTAGGAAGAGAAGAAGG + Intergenic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937845943 2:126578992-126579014 CACTGCTGAGGGAGGGAGGAAGG - Intergenic
938202677 2:129388232-129388254 CTCTGCTCAAGGTGGGAAGAGGG + Intergenic
938283553 2:130087158-130087180 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938284692 2:130101504-130101526 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938334187 2:130475722-130475744 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938335331 2:130490059-130490081 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938354491 2:130630608-130630630 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938355635 2:130644940-130644962 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938430914 2:131237388-131237410 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938432054 2:131251733-131251755 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938475726 2:131610342-131610364 TTCTGTTCAGGGAGGGAACCAGG + Intergenic
939302750 2:140367042-140367064 TTCTGTTTTGGGAGGAAGGAAGG + Intronic
939726560 2:145727653-145727675 CTCTGTCTAGGCAGGGTACAAGG + Intergenic
939930820 2:148230944-148230966 CTCCATTTAAGGAGAGAAGAAGG - Intronic
940979972 2:159990615-159990637 CTCTGTTAGAGGAGAGAAGAAGG - Intronic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
943329715 2:186544235-186544257 CTCTGTTTTAGGAAGAAAGAAGG - Intergenic
943345883 2:186736181-186736203 CTCAGTTTAGAGTGTGAAGATGG - Intronic
944454520 2:199879315-199879337 CCCAGTTTACGGAGGGAACATGG + Intergenic
946290095 2:218738109-218738131 CTCTTTTGAGGGAGAGAAAAAGG - Exonic
946878561 2:224155205-224155227 CTTTGTCTGGGCAGGGAAGATGG - Intergenic
946943726 2:224797727-224797749 TTCTCAGTAGGGAGGGAAGAAGG - Intronic
947387519 2:229606397-229606419 GTCTGTTTAGAGAGAGCAGAAGG + Intronic
948070136 2:235114208-235114230 CTCTGCCTAGGGTGGGAGGAAGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1169136429 20:3200523-3200545 CCCTGTTAGGGGAGGGACGAGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1171187568 20:23133718-23133740 CACTGGTTAGGGAGGGAGGAAGG + Intergenic
1171308038 20:24122715-24122737 CTTTCTTTAGGAAGGAAAGAAGG + Intergenic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1173315744 20:41941576-41941598 CTCTGTTCAGAGAGAGATGAAGG - Intergenic
1174097472 20:48100717-48100739 CTATGATTTGGGAGGGAATATGG + Intergenic
1174327369 20:49790035-49790057 CTCTGGTCGGGGAGGGAAGTAGG - Intergenic
1175716642 20:61259061-61259083 CTTTGTTTTAGGAAGGAAGAAGG + Intronic
1176818304 21:13629049-13629071 TTCTGTTCAGGGAGGGAACCAGG + Intronic
1177181930 21:17753708-17753730 CTCAGTTTGGGGGAGGAAGAGGG - Intergenic
1178336485 21:31748345-31748367 CTCTGTTTAAGAAGGCAAGGCGG + Intergenic
1178338635 21:31766370-31766392 CTCTGCTTGGGGAGTGCAGAAGG + Intergenic
1179392326 21:41005003-41005025 CTCAGTTGAGGGGGGCAAGATGG + Intergenic
1180476090 22:15708991-15709013 TTCTGTTTAGGGAGGGAACCAGG + Intronic
1181474265 22:23158842-23158864 CCCTGTTTGGGGTGGGAGGATGG + Intronic
1181577491 22:23804546-23804568 CTTTTTTTTGGGAGGGGAGATGG + Intronic
1183113946 22:35675211-35675233 CTCTGCTTTGGAAGGGAAGGGGG + Intergenic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
949847849 3:8390100-8390122 CTCTGTTAACTGAGGGAACAGGG + Intergenic
950154328 3:10710261-10710283 CTCTGTATGGGGAGGTAATAGGG + Intergenic
950310147 3:11950032-11950054 GTCGGATTTGGGAGGGAAGAGGG + Intergenic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
950998132 3:17526909-17526931 GTCTGTTGAGGAAGGAAAGAAGG + Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
954845436 3:53551696-53551718 CTCTTTTTAGTTAGGAAAGAAGG + Intronic
955237033 3:57148791-57148813 CTCTGTCTAGGGAGGCAGGTGGG + Intronic
955429383 3:58826885-58826907 TTCTGTTCAGGGTGGGATGAGGG + Intronic
955501724 3:59591712-59591734 GTCTTCTAAGGGAGGGAAGACGG - Intergenic
956515492 3:70042017-70042039 CTTTTTTGAAGGAGGGAAGATGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956938574 3:74131785-74131807 CTCTGTTAGGGCAGGGCAGAGGG - Intergenic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
958764961 3:98356754-98356776 TTCTGTCTCAGGAGGGAAGATGG + Intergenic
959681722 3:109104221-109104243 CTCTCTGTGGGGAGGGAAAAAGG + Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959851827 3:111096887-111096909 CTCTGTTAAGGCAGTGCAGAAGG + Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
963604346 3:147401536-147401558 CTCTGTTTAGGGTGGCAACCTGG - Intronic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964818838 3:160747706-160747728 CTCAGTTAAGTGAGGGGAGAAGG - Intergenic
965026109 3:163303774-163303796 TTCTGCTTAGGGAGAGGAGAGGG + Intergenic
966880246 3:184345931-184345953 CTCTTCTTGGGGAGGAAAGAAGG + Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967551857 3:190805093-190805115 CACTGCTTATGGTGGGAAGAAGG + Intergenic
967636028 3:191804325-191804347 CTCTGTATGGGGAAAGAAGAGGG + Intergenic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970581512 4:17477908-17477930 CTCTGGTTAGGGAGGCATGACGG - Intronic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971701544 4:29984186-29984208 TTCTGTTTAAGGAGAGGAGAAGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976082881 4:81375683-81375705 TTCTGTTTAAGGAGAGGAGAGGG - Intergenic
976316751 4:83666860-83666882 CTCTGTTTATGAATGGAAGTGGG + Intergenic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
978177789 4:105755295-105755317 CCCTGTCTAGGAAGGAAAGAAGG + Intronic
978225937 4:106335087-106335109 CTCTGTTGATGGGAGGAAGATGG + Intronic
978339560 4:107707575-107707597 CTTTGCTTAGGGGAGGAAGAGGG - Intronic
978654314 4:111048611-111048633 CTCTGCTTGAGGAGAGAAGAAGG + Intergenic
980880756 4:138707987-138708009 CTCTGCTTAGGGAGCCAAGCTGG - Intergenic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
984150472 4:176123818-176123840 CAATGTCCAGGGAGGGAAGAGGG - Intronic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985966956 5:3344868-3344890 CGCTGGTTAGGGAGGGTAGCTGG + Intergenic
986118841 5:4810613-4810635 ATTTGTTTAGATAGGGAAGAAGG + Intergenic
986650578 5:9959523-9959545 CTCTGTTAAAGGAGGGAGCAGGG + Intergenic
986885294 5:12226442-12226464 CTCTGCTTAAGGAGAGGAGATGG - Intergenic
987538810 5:19226113-19226135 CTCTGTTTTGGGGTGGAATAAGG + Intergenic
987621357 5:20341085-20341107 CTCTGGTTAGGGAAGGATGTGGG - Intronic
987903834 5:24050432-24050454 CTCTGCTTAAGGAGAGGAGAGGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990649838 5:57885884-57885906 CTCTTTTTAAGGAGGGAGAAGGG - Intergenic
990923841 5:60996443-60996465 TTCTGTTTAAGGAGAGGAGAGGG - Intronic
991951271 5:71948697-71948719 GTTTTTTTTGGGAGGGAAGAGGG + Intergenic
992073680 5:73171979-73172001 ATCTGTCTAGGAAGGAAAGAAGG + Intergenic
993005889 5:82427934-82427956 CTCAGTTTAGGGAGGCAAAGAGG - Intergenic
993516551 5:88843145-88843167 CTCATTTTTGGGAGGGATGAAGG + Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995652964 5:114391931-114391953 CTCTATTTAGGGCTGGAGGAAGG + Intronic
995715882 5:115081608-115081630 CTCTGGTTAGGAAAAGAAGATGG + Intergenic
995903522 5:117096126-117096148 CCCGATTTAGGGAGGAAAGAGGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998519169 5:142784146-142784168 CTCTGTTTAGAGCAGCAAGATGG + Intronic
999836069 5:155374362-155374384 CTCTGTTTTGGGTGGTAGGATGG - Intergenic
1000674607 5:164105547-164105569 CTCTACTAAGGGAGGGCAGAGGG + Intergenic
1001753587 5:174149680-174149702 CTCTGTTCAGAGAGGGACAAGGG + Intronic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1003911919 6:10750863-10750885 TTCTGTCTAAGGAGGGAAGATGG + Intronic
1003920129 6:10825123-10825145 CCATGTTCAAGGAGGGAAGAGGG - Intronic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006248701 6:32762154-32762176 CTTCCTTTAGGGAGGTAAGAGGG + Intronic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006756045 6:36416409-36416431 CTCTGTTTTGGGGAGGAATAAGG - Intronic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1008214999 6:48777903-48777925 TTCTGCTTGGGGAGAGAAGAGGG + Intergenic
1008302117 6:49854082-49854104 TTCTCTTTACTGAGGGAAGAAGG - Intronic
1008649213 6:53546046-53546068 CTCTGTAGTGCGAGGGAAGAGGG - Intronic
1010324643 6:74550560-74550582 TTCTGCTTAGGGAGAGGAGAAGG - Intergenic
1012201491 6:96411701-96411723 CACAGATCAGGGAGGGAAGAAGG - Intergenic
1012448621 6:99331730-99331752 CTCTGTCGAGGGAAGGAACATGG + Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012971455 6:105736038-105736060 CTCTGTTTAGAGAGGGTTGTGGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013750135 6:113396197-113396219 CACTGTTTAGTGAGGGTAAATGG + Intergenic
1013865449 6:114690884-114690906 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015101851 6:129490844-129490866 CACTGTTAAGGGGGTGAAGAAGG - Intronic
1015248836 6:131105401-131105423 GTCTGTTAAGGGAAGGAAAAGGG + Intergenic
1015819560 6:137245860-137245882 CTCAGTTTGGGGAGGAATGATGG + Intergenic
1016361310 6:143270215-143270237 CTCTGCTAAGTGTGGGAAGAGGG - Intronic
1017301144 6:152859534-152859556 CTTAGTTTGGGGAGAGAAGAGGG + Intergenic
1018560688 6:165098475-165098497 CTCTGGTTAGGAAGGGAGGTGGG - Intergenic
1019813264 7:3180866-3180888 CGTTGTTCAGGGAAGGAAGAGGG - Intergenic
1020343430 7:7137485-7137507 CTCTCCTGAGGGAGGGACGAAGG - Intergenic
1020461094 7:8431041-8431063 CTCTTTTTTGGCAGGGGAGAGGG - Intergenic
1020632936 7:10662317-10662339 CTCAGTCTAGGGTAGGAAGAGGG - Intergenic
1020760912 7:12267825-12267847 CTCTATTTAAAGGGGGAAGAGGG - Intergenic
1021841105 7:24722637-24722659 TTCTGTTTAGGGCGGGTAGGAGG - Intronic
1022748114 7:33193561-33193583 CTCTGATTGGGTAGGAAAGAAGG - Intronic
1023364933 7:39454356-39454378 CCATTTTTAGGGAGAGAAGAGGG - Intronic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1024347858 7:48331045-48331067 GTCTGAATAAGGAGGGAAGAGGG + Intronic
1024473749 7:49789726-49789748 ACCTGTTTGGGGAGAGAAGAAGG - Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1028171544 7:87602589-87602611 CACTGTTTAGGGAGGGTTTAAGG - Intronic
1028249681 7:88526192-88526214 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1029254812 7:99262460-99262482 CTCAGTTCAGTGTGGGAAGAGGG - Intergenic
1029526332 7:101096361-101096383 TCCTGTTTGGGTAGGGAAGAGGG + Intergenic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1031306211 7:120130725-120130747 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1031379780 7:121071385-121071407 TTCTGTTTTGTGAGGGAAAATGG - Intronic
1032948093 7:136874581-136874603 CTTGGATTTGGGAGGGAAGAGGG - Intronic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033590968 7:142808098-142808120 CTCTGTTTGGTGGGGGAGGAGGG + Intergenic
1034760235 7:153665533-153665555 TTCTGTTTTGGGAGGGGAGGGGG + Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035740991 8:1928625-1928647 ATCTGTGTAGGGACGGAGGAGGG + Exonic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1037919757 8:22797528-22797550 CTTCGTTTTGGGAGAGAAGAAGG + Intronic
1038048568 8:23788284-23788306 CACTGTGTAGGGTGGGAGGAGGG + Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1040531154 8:48267409-48267431 CTCTGCCTAGGGAGGAAGGAAGG + Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1040737755 8:50531502-50531524 ATCTGGATCGGGAGGGAAGAAGG - Intronic
1041804639 8:61836745-61836767 CTCTGTCTAGGGAGGGTGGGGGG + Intergenic
1042716702 8:71780969-71780991 TTTTTTTTAGGGAAGGAAGAAGG + Intergenic
1042761533 8:72276571-72276593 CTCTGTTAGGGCAGTGAAGAGGG + Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043262527 8:78220106-78220128 CTCTGCTAGGGCAGGGAAGAAGG - Intergenic
1043285258 8:78519921-78519943 ATCTGGTTGGGGAAGGAAGATGG - Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1046750429 8:117920948-117920970 GTATGTTTAGGGAGGGACGAGGG - Intronic
1047037920 8:120959993-120960015 CTATGTTTAGAAAGGGTAGAAGG + Intergenic
1047954552 8:129963589-129963611 CTCTATTCAGGCAGTGAAGATGG + Intronic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1051959419 9:22739983-22740005 CTTTGTTTAGCTAGGGAAAATGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1052235646 9:26210930-26210952 CTCTCTGTAAGGAGGGAAGGGGG - Intergenic
1054948241 9:70820152-70820174 CTCTGTTTACTGAGGCAGGAGGG + Intronic
1056516715 9:87359180-87359202 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1059007031 9:110414076-110414098 CTCTGTTTTGAAAGTGAAGAAGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061934329 9:133849114-133849136 TTCCCTTTAGGGAGCGAAGATGG - Intronic
1061943346 9:133894566-133894588 CTCTGTCCAGGGAGGCATGAGGG + Intronic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062437589 9:136553442-136553464 CTCAGTGTAGGGGGGGAAGGGGG + Intergenic
1203529055 Un_GL000213v1:120454-120476 TTCTGTTCAGGGAGGGAACCAGG - Intergenic
1186229144 X:7434456-7434478 CCTCGTTTAGGGAGGGTAGAGGG - Intergenic
1186364036 X:8873111-8873133 CTCTGTTTGGGTAGGGATGATGG - Intergenic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1189399036 X:40647782-40647804 CTCTGTTTGGGGGACGAAGAGGG - Intergenic
1189620297 X:42829868-42829890 CTCTGATTAGGGAGTGACAATGG - Intergenic
1189911197 X:45812041-45812063 CTATGTTTCAGGAGGCAAGAAGG - Intergenic
1190970464 X:55342867-55342889 CTCTGTGTAGGGTGGGAACTTGG - Intergenic
1192094984 X:68201210-68201232 CATTTTTGAGGGAGGGAAGATGG - Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1194006757 X:88504260-88504282 CTCTGCTTTAGGAGAGAAGAGGG + Intergenic
1194297405 X:92143678-92143700 CTCTGCTAAGGCAGTGAAGAAGG + Intronic
1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG + Intergenic
1195574935 X:106439016-106439038 CACAGATTGGGGAGGGAAGAGGG - Intergenic
1196366322 X:114928253-114928275 CTATGCTTTGGGAGAGAAGATGG - Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197355860 X:125436942-125436964 TTCTGTTTAGGAAGAGAAGTGGG + Intergenic
1197681115 X:129386463-129386485 ATGTCTTTAGGCAGGGAAGAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198822102 X:140659453-140659475 CTCTGTTTGGGAAGTGAGGAGGG - Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1199752387 X:150832682-150832704 CTCTCTGTAGGAAAGGAAGAAGG + Intronic
1199811298 X:151352500-151352522 CCCTGTTTAGGGGGGAAGGATGG + Intergenic
1199853305 X:151740402-151740424 CTCTCTCTAGGGAGGGATGTGGG + Intronic
1200614975 Y:5368579-5368601 CTCTGCTAAGGCAGTGAAGAAGG + Intronic
1201699776 Y:16867843-16867865 CTCTGCTTCGAAAGGGAAGAAGG + Intergenic