ID: 1152081631

View in Genome Browser
Species Human (GRCh38)
Location 17:78191073-78191095
Sequence CACCCAATGCGGCCACGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152081631_1152081639 14 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081639 17:78191110-78191132 GCAGTGATTCAGAATGCTGGGGG 0: 1
1: 0
2: 1
3: 19
4: 186
1152081631_1152081637 12 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081637 17:78191108-78191130 TGGCAGTGATTCAGAATGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1152081631_1152081641 19 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081641 17:78191115-78191137 GATTCAGAATGCTGGGGGTTGGG 0: 1
1: 1
2: 1
3: 30
4: 344
1152081631_1152081636 11 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081636 17:78191107-78191129 GTGGCAGTGATTCAGAATGCTGG 0: 1
1: 0
2: 1
3: 7
4: 155
1152081631_1152081642 20 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081642 17:78191116-78191138 ATTCAGAATGCTGGGGGTTGGGG 0: 2
1: 0
2: 2
3: 37
4: 566
1152081631_1152081640 18 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081640 17:78191114-78191136 TGATTCAGAATGCTGGGGGTTGG 0: 1
1: 0
2: 3
3: 53
4: 695
1152081631_1152081638 13 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081638 17:78191109-78191131 GGCAGTGATTCAGAATGCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 265
1152081631_1152081644 22 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081644 17:78191118-78191140 TCAGAATGCTGGGGGTTGGGGGG 0: 1
1: 1
2: 5
3: 67
4: 534
1152081631_1152081645 23 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081645 17:78191119-78191141 CAGAATGCTGGGGGTTGGGGGGG 0: 1
1: 0
2: 5
3: 99
4: 776
1152081631_1152081634 -8 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081634 17:78191088-78191110 ATTGGGTGTCCTTAAGCATGTGG 0: 1
1: 0
2: 1
3: 6
4: 87
1152081631_1152081643 21 Left 1152081631 17:78191073-78191095 CCTCTCCGTGGCCGCATTGGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152081643 17:78191117-78191139 TTCAGAATGCTGGGGGTTGGGGG 0: 1
1: 1
2: 3
3: 102
4: 1118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152081631 Original CRISPR CACCCAATGCGGCCACGGAG AGG (reversed) Intronic
900338871 1:2178387-2178409 CACCCACTGCGTCCACTGCGTGG + Intronic
901510384 1:9715489-9715511 CACCCAAGGCAGCCACTGGGAGG - Intronic
902690783 1:18109137-18109159 CACCCAGTGCCGCCGCGTAGTGG + Intronic
903442917 1:23401766-23401788 CACCCCCTGGGGCCACGGACTGG + Intronic
904270714 1:29348197-29348219 CACCCAATACGGCAGAGGAGTGG + Intergenic
905749658 1:40451023-40451045 ATCCAAAGGCGGCCACGGAGCGG + Exonic
906769496 1:48471767-48471789 CTCCCACTCCGGCCACGCAGAGG - Intronic
917944504 1:179955011-179955033 CACCCGGTGCGTCCCCGGAGCGG + Exonic
1066461421 10:35615710-35615732 CACTCAATGGGGCCAGGGTGTGG + Intergenic
1067538852 10:47137109-47137131 CACTCAAGGCGGACACAGAGTGG + Intergenic
1072152884 10:92697156-92697178 CACCCAAAGTGGCCACCCAGTGG + Intergenic
1076611028 10:131725975-131725997 CAGCCAGGGCGGCCACCGAGTGG + Intergenic
1089630748 11:119782736-119782758 GACCCAATGTGGCCTCGGAGAGG - Intergenic
1092501131 12:9049261-9049283 CCCACAATGTGGCCACAGAGTGG + Intergenic
1098577523 12:72060106-72060128 CCCACAATGAGGCCACGGGGAGG + Intronic
1122362893 14:101177880-101177902 CACCCACTGAGGCCAGAGAGGGG + Intergenic
1122785574 14:104161911-104161933 CACCCAACACTGCCAGGGAGCGG - Intronic
1130510218 15:84583021-84583043 CTCCAAATGCAGCCACAGAGAGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131582579 15:93659457-93659479 CATCCAATCTGGCCACGGGGTGG - Intergenic
1133281522 16:4668188-4668210 CAACCCAGGCGGCCACGCAGGGG + Intronic
1133526038 16:6606526-6606548 CACACAATGGGGCCTCGTAGAGG - Intronic
1134384192 16:13756695-13756717 CAGCCAATGGGGGCACGGTGGGG - Intergenic
1142903299 17:3026618-3026640 CACCCACTGCGCCCAGGGGGTGG - Intronic
1152081631 17:78191073-78191095 CACCCAATGCGGCCACGGAGAGG - Intronic
1152560404 17:81075784-81075806 GCCCCAATGTGCCCACGGAGGGG - Intronic
1153000976 18:455143-455165 GCCACAATGCGGCCATGGAGCGG - Intronic
1154110702 18:11566193-11566215 CTCCAAATGCAGCCACAGAGGGG - Intergenic
1160846435 19:1168186-1168208 CACCCAACGCTGCCCCGGGGTGG - Intronic
1161571912 19:5035479-5035501 CACCCAAGGCCGCCACGTGGAGG - Intronic
1163128232 19:15255967-15255989 CACCCAATGAGGACAGGGAGGGG + Intronic
930612146 2:53555019-53555041 CACCCACTGCTGCCACAGGGTGG - Intronic
930984832 2:57572918-57572940 CACCCAGTGCGGCCACATTGGGG - Intergenic
942965911 2:181892053-181892075 CCCCCAGTGCGGCCATGGACCGG + Exonic
946832396 2:223740027-223740049 CACCCACTGGGGCCGCTGAGCGG + Intergenic
948720482 2:239896525-239896547 CAGCCAGTGGGGCCACGGAAGGG + Intronic
948874601 2:240820012-240820034 CACCCACTGCGCCCAGGGCGGGG - Intronic
1174538708 20:51272963-51272985 CATCCAGTGTGGCCACTGAGTGG + Intergenic
1179167721 21:38947678-38947700 CACCCAATGCGTCCATGTAGAGG - Intergenic
1179797522 21:43794053-43794075 CACCCAATGGGGACACTGAAAGG + Intronic
1184499588 22:44863669-44863691 CACCCCAAGCAGGCACGGAGGGG - Intergenic
1184774796 22:46617763-46617785 CACCCAGGGGGGCCAGGGAGCGG - Intronic
954622136 3:52002367-52002389 TACCCAATGAGGCCATGGAGGGG + Intergenic
956562465 3:70595389-70595411 CACCAAATGCTGCTATGGAGGGG - Intergenic
979972178 4:127149036-127149058 CACCTACTGAAGCCACGGAGAGG + Intergenic
983181009 4:164649091-164649113 CAGCCAATGCAGCCACGTGGTGG - Intergenic
985687142 5:1288596-1288618 CACCCAAGGGGGCCAAGCAGAGG + Intronic
1000360138 5:160439360-160439382 CAGCCAAAGCCACCACGGAGGGG - Intergenic
1002069846 5:176672733-176672755 TCCCCAATGCGGGCACAGAGAGG + Intergenic
1005281984 6:24284189-24284211 CCCCCACTGCGGCCACCTAGCGG + Intronic
1025301568 7:57822714-57822736 CACCCAAAGCGGCTTCGCAGCGG - Intergenic
1049789997 8:144468139-144468161 CACTCAGAGGGGCCACGGAGAGG - Intronic
1057316797 9:93974450-93974472 GCCCCAATGGGGCCACGGGGGGG + Intergenic
1194123960 X:89991344-89991366 CAACCATTGCAGCCAGGGAGAGG + Intergenic
1200476848 Y:3648966-3648988 CAACCATTGCAGCCAGGGAGAGG + Intergenic