ID: 1152083415

View in Genome Browser
Species Human (GRCh38)
Location 17:78202828-78202850
Sequence GCAACCAAACTGCCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152083409_1152083415 5 Left 1152083409 17:78202800-78202822 CCTGGGGGACTCCTCCTCCAGGG 0: 1
1: 0
2: 6
3: 29
4: 281
Right 1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1152083406_1152083415 13 Left 1152083406 17:78202792-78202814 CCACTTTCCCTGGGGGACTCCTC 0: 1
1: 0
2: 1
3: 32
4: 299
Right 1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1152083407_1152083415 6 Left 1152083407 17:78202799-78202821 CCCTGGGGGACTCCTCCTCCAGG 0: 1
1: 0
2: 2
3: 27
4: 271
Right 1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1152083411_1152083415 -6 Left 1152083411 17:78202811-78202833 CCTCCTCCAGGGCTGCCGCAACC 0: 1
1: 0
2: 1
3: 30
4: 415
Right 1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1152083412_1152083415 -9 Left 1152083412 17:78202814-78202836 CCTCCAGGGCTGCCGCAACCAAA 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152083415 Original CRISPR GCAACCAAACTGCCACAAGC TGG Intronic
902945226 1:19831320-19831342 GCAGCCAGACAGCCACAAGAAGG + Intergenic
904386408 1:30145368-30145390 CCAAACAAACTGCCACGAACTGG - Intergenic
905302551 1:36995707-36995729 GCAGCCACACTGCCAGAAACAGG + Intronic
908660712 1:66432211-66432233 GCACAGAAACTGCCACAGGCAGG - Intergenic
909563628 1:77031435-77031457 GCATCAACACTGCCACAATCTGG + Intronic
910487869 1:87735769-87735791 GCAACAACTCTCCCACAAGCTGG - Intergenic
910730776 1:90393456-90393478 GCAACAAGACAGCCACAAGCAGG - Intergenic
913293801 1:117299763-117299785 GCATACAGACTGCCACATGCAGG - Intergenic
922378121 1:224990506-224990528 GCAATCAAACTGAAAAAAGCAGG - Intronic
923869151 1:237972222-237972244 GTAACCAAACAGCCACAGTCAGG - Intergenic
1063443242 10:6089840-6089862 GAAACCAAACTCCTGCAAGCAGG - Exonic
1065810002 10:29433305-29433327 GCAACAAAACTGATTCAAGCAGG - Intergenic
1066112836 10:32212422-32212444 GCAACATACCTGCCACATGCTGG + Intergenic
1067666854 10:48286396-48286418 GAAAACATCCTGCCACAAGCAGG - Intergenic
1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG + Intergenic
1070832135 10:79424612-79424634 GCCTCCAACCTGCCACTAGCAGG + Intronic
1076076831 10:127540096-127540118 GCCACCAAAGGGCCACAAGCAGG - Intergenic
1076235090 10:128857894-128857916 GCAACCCAACTGGAACAAACAGG - Intergenic
1078665895 11:13324904-13324926 GCCCCCACACTGCCACCAGCTGG - Intronic
1081749609 11:45500614-45500636 GCAACCAGACTGCCAGATGAAGG + Intergenic
1083932870 11:65855410-65855432 GCAAGCAAACTGCTACGAGGAGG - Exonic
1095354204 12:41252301-41252323 GTAACCCAAATGCCACAAACAGG + Intronic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1103894746 12:124265464-124265486 GTGACCAAACAGCCACCAGCAGG - Intronic
1106176979 13:27340070-27340092 GAAACCAGACTGCCCCAAGAAGG - Intergenic
1107838220 13:44429275-44429297 CCAGGCAAACTGCGACAAGCTGG - Intergenic
1108548560 13:51520702-51520724 CAAAACAAACTGCCACAAGCTGG + Intergenic
1110833574 13:80059160-80059182 GTAACCACACTGCAACAAACTGG - Intergenic
1114979295 14:28142614-28142636 GTAGCCACACTGCCACAAGGTGG - Intergenic
1116869266 14:50056134-50056156 GCAAGCAGCCTGCCAGAAGCCGG + Intergenic
1119703241 14:76769034-76769056 GCAGCCAAACTGCCAGATCCGGG + Intronic
1120092087 14:80343764-80343786 GCAGACAAACTACCAGAAGCTGG - Intronic
1122883229 14:104699422-104699444 GCAACCCTACTGCCACCAGGAGG + Intronic
1123058976 14:105585912-105585934 GCACCCAGACTCCCACAAGGGGG - Intergenic
1123083306 14:105706143-105706165 GCACCCAGACTCCCACAAGGGGG - Intergenic
1124583483 15:30983746-30983768 TCAAGCAAACTGGGACAAGCTGG + Intronic
1126279058 15:46922004-46922026 GAAACCATACTGCCACTGGCGGG + Intergenic
1130878297 15:88032863-88032885 GGGACACAACTGCCACAAGCCGG - Exonic
1132049643 15:98596431-98596453 TCAACCAATTTTCCACAAGCAGG + Intergenic
1137763705 16:50961203-50961225 GCAACAAAACTGCACCATGCAGG - Intergenic
1138513591 16:57523362-57523384 GCCAGCAAACTGCCAGAAGCTGG - Intronic
1142676888 17:1519127-1519149 GCAAACAAACTGACAAAAACAGG + Exonic
1143839231 17:9718460-9718482 GCAGCCCAAATGCCACACGCTGG - Intronic
1147857454 17:43492995-43493017 GCAACCAAACTGCATGATGCTGG - Exonic
1149628424 17:58097564-58097586 CCAATCAACCTGCCACAAGGTGG + Intergenic
1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG + Intronic
1161486383 19:4538110-4538132 GCAGCCAAACTGGGACATGCGGG - Exonic
1163205210 19:15797477-15797499 TCAACCAAACTACAGCAAGCTGG - Intergenic
1166080416 19:40440936-40440958 GAAACCAAACTGCTCCATGCCGG - Exonic
928432755 2:31234308-31234330 GCAAGGAAACTGCCAGATGCCGG - Intergenic
929052745 2:37851873-37851895 GCAAGCAAACAGCCACAGGAAGG - Intergenic
931236497 2:60417385-60417407 GAAACCTCACTGCCAGAAGCAGG + Intergenic
937628880 2:124076476-124076498 TCAACCAAATTGCCATAATCAGG - Intronic
940708202 2:157129998-157130020 GCACACAAACTGACACAAACTGG + Intergenic
942937991 2:181581705-181581727 GCAATCAACCTGCCACCAGGTGG + Intronic
943763696 2:191637342-191637364 GCAGCCATATTGCCACCAGCTGG + Intergenic
944082455 2:195803627-195803649 GCAACCATTCTCCCACAGGCAGG + Intronic
944121171 2:196242388-196242410 TCAACCAAAATGCCACAAAGAGG - Intronic
947956396 2:234195820-234195842 TGAAGCAAAGTGCCACAAGCTGG + Intergenic
1173531913 20:43776286-43776308 GGTAACAAAGTGCCACAAGCGGG + Intergenic
1174934518 20:54853018-54853040 GCAACAAAACTGCCCTATGCTGG - Intergenic
1176277236 20:64279304-64279326 GCAAAGAAACTACCAGAAGCTGG - Intronic
1177107267 21:16975282-16975304 AAAACCAGACTGCCCCAAGCTGG - Intergenic
1177239083 21:18432779-18432801 CTAAACAAAGTGCCACAAGCTGG - Intronic
1178404711 21:32314843-32314865 TCAACCAAACTTCTAGAAGCTGG + Exonic
1181138278 22:20784911-20784933 GCAACCAAACTGAGAAAAGTAGG + Intronic
1183095549 22:35549834-35549856 GCAGCCATTCTGCCAGAAGCTGG + Intronic
1184486914 22:44785289-44785311 GCCAGCAAAGTGCCACAACCTGG + Intronic
1184682800 22:46080982-46081004 CCACACAAACTGCCACAACCAGG - Intronic
951461955 3:22960553-22960575 GCAACCATGCAGCCACAAGGAGG - Intergenic
955205728 3:56894164-56894186 CCCACCAAACTGTCAGAAGCTGG - Intronic
957047618 3:75388499-75388521 CCAAGCACACTGCCACAGGCTGG + Intergenic
957915827 3:86686974-86686996 CCAACAACACTGCCACAAGAGGG + Intergenic
959630409 3:108501065-108501087 GTAACAAAACTACCACAAGCTGG - Intronic
962868241 3:139465702-139465724 GAAAACAAACTGCCTCAAACAGG - Intronic
962934646 3:140068571-140068593 GGAATCAAACTGTCACAAGGTGG - Intronic
963669059 3:148229463-148229485 GCCACCAAACTCCCAGAAGCAGG - Intergenic
964210457 3:154221008-154221030 GCCAGCAAACTACCAGAAGCTGG + Intronic
976020558 4:80619265-80619287 TGAACCAAAATGCCACAAGGTGG + Intronic
976395496 4:84550675-84550697 GCAACCAGACTGCTTTAAGCTGG + Intergenic
978438402 4:108709809-108709831 ACAACCAAACTGCCACCTCCAGG - Intergenic
980615050 4:135208733-135208755 ATAATCAATCTGCCACAAGCTGG - Intergenic
982559315 4:156910149-156910171 GGTAACAAACTGCCCCAAGCAGG - Intronic
985846269 5:2351757-2351779 TCAAACAAAGTGCCACAAGGTGG - Intergenic
993787650 5:92163801-92163823 GCAACCAAACTGCCACCCCAGGG + Intergenic
993817020 5:92561312-92561334 GCAATCAGTATGCCACAAGCGGG - Intergenic
995540846 5:113184622-113184644 GAAACCAAACTGCTATAAGCTGG - Intronic
996440869 5:123488940-123488962 CCTCCCAAACTGCCACTAGCTGG - Intergenic
1005315199 6:24597308-24597330 GGAAGCAAACTGTCACAAGGAGG + Intronic
1010068552 6:71715163-71715185 GCTAGCAAACTGCCAGAAGCTGG - Intergenic
1010579433 6:77575691-77575713 TCTACCAAAGTACCACAAGCTGG - Intergenic
1017185912 6:151600346-151600368 GCTACCCAACTACCACAAACTGG + Intronic
1017642443 6:156507404-156507426 GCAACCAAAATGTCTCAAGGTGG - Intergenic
1018768440 6:166952279-166952301 GTAACAAAAGTGCCACAAGCTGG - Intronic
1018907670 6:168084883-168084905 GCAACCAAACAGCCACAGCAGGG + Intergenic
1019796985 7:3057466-3057488 GCAACGTAACTGTCACACGCTGG - Intergenic
1019859703 7:3646176-3646198 GGAACCAAACTCACACAAGGAGG - Intronic
1021981852 7:26063090-26063112 GAAGCTAAACTGCCTCAAGCTGG - Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029252395 7:99246277-99246299 CAAACCCAGCTGCCACAAGCAGG + Intergenic
1032952978 7:136937996-136938018 GCAACCACACTGGCACAGACAGG + Intronic
1034496102 7:151423550-151423572 GCCAGCAAACCGCCAGAAGCTGG - Intergenic
1045506682 8:102783570-102783592 GCTTCCAAACTGCAATAAGCTGG + Intergenic
1046521909 8:115335868-115335890 GAAATCAAACTGCAAGAAGCTGG + Intergenic
1048457573 8:134591929-134591951 GCAATCAAAGTGCCACATGCTGG - Intronic
1062278158 9:135740335-135740357 GCTCCCAAACTCCCCCAAGCAGG + Intronic
1185690826 X:2153965-2153987 CAAAGCAAACTGCCACAAACTGG - Intergenic
1189953971 X:46259697-46259719 TCAATCGAACTGCCATAAGCTGG - Intergenic
1199136301 X:144256956-144256978 GGAGTCAAACTGCCACAAGTTGG + Intergenic
1199704981 X:150416560-150416582 GCAACCAAACGCATACAAGCAGG - Intronic
1201685901 Y:16702203-16702225 GTAACAAAAGTACCACAAGCAGG + Intergenic
1202058712 Y:20863623-20863645 CCAACCAAACCCCCACAATCTGG - Intergenic