ID: 1152083563

View in Genome Browser
Species Human (GRCh38)
Location 17:78203778-78203800
Sequence CTTTGGAAGGGCAAGGCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154132
Summary {0: 1, 1: 44, 2: 1747, 3: 28241, 4: 124099}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152083556_1152083563 -8 Left 1152083556 17:78203763-78203785 CCTGTAATCCCAACACTTTGGAA 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
Right 1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG 0: 1
1: 44
2: 1747
3: 28241
4: 124099
1152083554_1152083563 11 Left 1152083554 17:78203744-78203766 CCAGGTACGGTGGCTCACGCCTG 0: 418
1: 20445
2: 93970
3: 160128
4: 170987
Right 1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG 0: 1
1: 44
2: 1747
3: 28241
4: 124099

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152083563 Original CRISPR CTTTGGAAGGGCAAGGCGGA CGG Intronic
Too many off-targets to display for this crispr