ID: 1152086095

View in Genome Browser
Species Human (GRCh38)
Location 17:78219682-78219704
Sequence GACCATCTCTTAGCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152086092_1152086095 1 Left 1152086092 17:78219658-78219680 CCAGCTTTTCTGCAGCGTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1152086095 17:78219682-78219704 GACCATCTCTTAGCCCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1152086091_1152086095 17 Left 1152086091 17:78219642-78219664 CCAGGTCAGGGGTCAGCCAGCTT 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1152086095 17:78219682-78219704 GACCATCTCTTAGCCCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152086095 Original CRISPR GACCATCTCTTAGCCCTCGT GGG Intronic
901499327 1:9641800-9641822 GGCCACCTCTCAGCCCTCCTTGG + Intergenic
902272020 1:15311362-15311384 AACCATCTCGAAGCCCACGTAGG + Intronic
916313554 1:163423215-163423237 GTCCCTGTCTTTGCCCTCGTTGG + Intergenic
922912175 1:229226879-229226901 TGACATCTCTTAGCCCTGGTAGG + Intergenic
1066883530 10:40757860-40757882 GGCCCTCTTTGAGCCCTCGTTGG + Intergenic
1074031220 10:109690486-109690508 GACCATCTCTGAGCTCTGGCTGG - Intergenic
1084840117 11:71839807-71839829 GACAGTCTCTCAGCCCTCGCAGG + Intergenic
1091138440 11:133214908-133214930 GGCAATCTCTGACCCCTCGTTGG + Intronic
1096626363 12:52898546-52898568 GACCAACTCCTAGCCCTTCTTGG + Intronic
1103353916 12:120305581-120305603 CACCATCTCTCATCCCTCATGGG + Intronic
1113838348 13:113344291-113344313 TGCCGTCTCTTAGCCCTTGTGGG - Intronic
1114574245 14:23697946-23697968 GACTATCTCCTAGCCCTAGAAGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1129331545 15:74830388-74830410 GACACACTCTTAGCCCTCATGGG - Exonic
1132535635 16:478152-478174 GACCCTCTGGTAGCCCTCGCAGG + Intronic
1134596895 16:15502837-15502859 GACCATCTCTTGGCCCCTCTAGG - Intronic
1136455077 16:30375823-30375845 GTCCTTCTCTTGGCCCTCTTGGG - Exonic
1148786138 17:50147189-50147211 GACCACCTCCTACCCCTCCTCGG + Intronic
1152086095 17:78219682-78219704 GACCATCTCTTAGCCCTCGTGGG + Intronic
1169030401 20:2402385-2402407 GACCATCTCTTTGCTCCCCTTGG + Intronic
1172221635 20:33278120-33278142 GACCAGATCTCTGCCCTCGTGGG - Intronic
1175375469 20:58520794-58520816 GACCATCTGCAAGCCCTGGTGGG - Intergenic
1179271276 21:39853015-39853037 GAACAGATCTTAGCCATCGTGGG + Intergenic
1184420640 22:44381058-44381080 TGCCAGCTCTTAGCCCTCGCGGG + Intergenic
968040822 3:195587887-195587909 GACAATGTCTCAGCCCTTGTGGG + Intergenic
969643354 4:8412295-8412317 GACCACCTCTTATCCCTGCTGGG + Intronic
969781207 4:9405810-9405832 GACAGTCTCTCAGCCCTCGCAGG + Intergenic
971218226 4:24681424-24681446 GACAAGCTCTTTGCCCTCTTGGG + Intergenic
978921531 4:114189246-114189268 GACAATCACTTAGCTCTCATAGG + Intergenic
998881595 5:146650920-146650942 CACCATCACTTAGCCCTGGTGGG + Intronic
1003967163 6:11263918-11263940 GAGCATCTCTTAGTCTTCTTAGG + Intronic
1004171745 6:13300557-13300579 GCACATCTCCTAGCCCACGTGGG - Intronic
1024574860 7:50755279-50755301 GACCTTCTCTTTGTCCTGGTTGG - Intronic
1036278640 8:7379727-7379749 GACAGTCTCTCAGCCCTCGCAGG + Intronic
1036838223 8:12092896-12092918 GACGGTCTCTCAGCCCTCGCAGG - Intergenic
1036860013 8:12339144-12339166 GACGGTCTCTCAGCCCTCGCAGG - Intergenic
1040560396 8:48518523-48518545 GACCATTTCTCATCCCTCATGGG + Intergenic
1048698595 8:137057718-137057740 TACCTTCTCTTAGCCGTCCTGGG + Intergenic
1056082337 9:83108550-83108572 GATAATCTCTTAGCCTTCATTGG - Intergenic
1061071049 9:128310978-128311000 GGCCATCTCATAGGCCTCCTGGG + Exonic
1061797021 9:133091559-133091581 GACCATTTCCTAGCCCAGGTTGG - Intergenic
1198877449 X:141242383-141242405 TACCATCTCGTTGGCCTCGTTGG + Exonic
1198908132 X:141584604-141584626 TACCATCTCGTTGGCCTCGTTGG + Exonic
1198908659 X:141589820-141589842 TACCATCTCGTTGGCCTCGTTGG - Exonic
1198918411 X:141698331-141698353 TACCATCTCGTTGGCCTCGTTGG + Exonic