ID: 1152089017

View in Genome Browser
Species Human (GRCh38)
Location 17:78236830-78236852
Sequence GTGACCAATACCAAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152089017_1152089021 8 Left 1152089017 17:78236830-78236852 CCAGCAGCCTTGGTATTGGTCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1152089021 17:78236861-78236883 TGAGAACAACAGTGAAGTCAAGG 0: 1
1: 0
2: 1
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152089017 Original CRISPR GTGACCAATACCAAGGCTGC TGG (reversed) Intronic
900018030 1:167995-168017 GTGGACAATCCCAGGGCTGCCGG - Intergenic
900048288 1:526591-526613 GTGGACAATCCCAGGGCTGCCGG - Intergenic
900876001 1:5343104-5343126 CTGACTGATGCCAAGGCTGCAGG + Intergenic
900924938 1:5699105-5699127 GTGACTGAGACCAAAGCTGCAGG + Intergenic
902557260 1:17254257-17254279 GAGACCAAGACCCAGGCAGCTGG - Intronic
905888931 1:41507827-41507849 GTGACATATACCCAGGCTGGTGG + Exonic
906544848 1:46613644-46613666 GTGACCAACAGCAAGTCTGAGGG - Intronic
915406756 1:155665711-155665733 AAGACCAAGACCAAGGTTGCAGG + Intronic
915525576 1:156474047-156474069 CTGACCAATCTCTAGGCTGCAGG - Intronic
915663023 1:157419360-157419382 GTGACCAATACCAACCCTAGTGG - Intergenic
924949778 1:248871993-248872015 TTGATCAATATCAAGGCTGGGGG - Intergenic
1064269852 10:13854848-13854870 GTGTCCACAACCAAGGCTGCAGG + Intronic
1067188259 10:44048531-44048553 GTCACCTATAGCAAGGTTGCAGG - Intergenic
1071694061 10:87853448-87853470 GTTATCAATACTAGGGCTGCTGG - Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072983450 10:100118941-100118963 GTGACCAAGGCCACGGCAGCGGG - Intergenic
1074607507 10:114988452-114988474 GGGCCCAAGACCAAGGCTGGAGG - Intergenic
1075760607 10:124852927-124852949 GTGACCAAGAGCAAAGCTCCAGG - Intergenic
1084899954 11:72302192-72302214 ACGACAAATCCCAAGGCTGCTGG + Intronic
1087360343 11:97150692-97150714 CTGACCAACAGCAATGCTGCAGG - Intergenic
1090728788 11:129551777-129551799 GGCACCAATACCAAGGCTTTGGG - Intergenic
1097475258 12:60047344-60047366 GACACCAATACCAAGCCTGCCGG - Intergenic
1102463018 12:113111985-113112007 GTGACCAGAACCTAGGCTGCCGG - Intronic
1111833315 13:93356666-93356688 GTCTTCAATACCAATGCTGCTGG - Intronic
1113770897 13:112908157-112908179 GTGTCCAATGCCAAGGGTGTGGG + Intronic
1113972789 13:114202774-114202796 ATCACCATTCCCAAGGCTGCAGG - Intergenic
1119573725 14:75699319-75699341 GTAACCAATACAAAGGGTGAAGG - Intronic
1121771387 14:96545429-96545451 GTCACCAATGCTAACGCTGCTGG - Intronic
1129960136 15:79676580-79676602 GTTACCAAGACCAAGCCTGAGGG - Intergenic
1130613243 15:85380430-85380452 GAGACCAATAGTAAGGCTCCTGG - Intergenic
1135988173 16:27199811-27199833 ATGGCCAATTCTAAGGCTGCTGG + Intergenic
1137762592 16:50952631-50952653 GTGGACAAAACGAAGGCTGCTGG + Intergenic
1139751708 16:69112923-69112945 GAGACCAGTAATAAGGCTGCTGG - Intronic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1142445634 16:90134467-90134489 GTGGACAATCCCAGGGCTGCCGG + Intergenic
1144738801 17:17569708-17569730 GTAACCAACATCAAAGCTGCTGG - Intronic
1146813298 17:35921546-35921568 ATGACCAATTCCAAGGCTCACGG + Intronic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1152089017 17:78236830-78236852 GTGACCAATACCAAGGCTGCTGG - Intronic
1153331671 18:3880467-3880489 GAGATCAATACCAGGCCTGCAGG - Intronic
1153663795 18:7350162-7350184 GTGACCAGTACCAAGGGTCCTGG - Intergenic
1154279447 18:12989935-12989957 TTTGCAAATACCAAGGCTGCAGG + Intergenic
1160553036 18:79707217-79707239 GTGACCCATACCCTGCCTGCTGG - Intronic
1167095304 19:47372212-47372234 TTGACCTAAACAAAGGCTGCAGG + Intronic
925161996 2:1692070-1692092 GTGACCTTTTCCAAGGCTGTCGG - Intronic
925745603 2:7040950-7040972 GTGACCATTTCCATGGCAGCAGG + Exonic
928419447 2:31126454-31126476 GTGACGAACACCAAGGCTTAAGG - Intronic
934860521 2:97760622-97760644 GTGTGAAATGCCAAGGCTGCTGG + Exonic
937329399 2:121016444-121016466 GTGAGCACTCACAAGGCTGCTGG - Intergenic
939879503 2:147613853-147613875 GTGTCCAGCACCAAGGCTGAAGG - Intergenic
948609851 2:239159822-239159844 GTGTCCCATCCCCAGGCTGCAGG - Intronic
1169466657 20:5847212-5847234 GAGACCAAGACCAAGTCTCCAGG - Intronic
1175525540 20:59630993-59631015 GTGACCACCACCAGGGATGCTGG + Intronic
1175527916 20:59648321-59648343 GTGAAGAATACCAAAGCTGTAGG + Intronic
1175860944 20:62149695-62149717 CTGACCAATTACAAGGCTGCTGG - Intronic
1176063367 20:63181906-63181928 AGGACCAATGCCAAGCCTGCTGG - Intergenic
1177806918 21:25883819-25883841 GTGGCTAATCCCAAGGCAGCTGG + Intronic
1178954479 21:37010155-37010177 GTGACCTGTACCAGGGCTCCCGG + Intronic
1184261598 22:43320509-43320531 GTGACCTTTATCAAGGCTACTGG - Intronic
953476599 3:43210698-43210720 GTGCCCAAGACTACGGCTGCTGG + Intergenic
956012202 3:64843864-64843886 GTAACCAAAGCCCAGGCTGCTGG - Intergenic
965816423 3:172641450-172641472 GATTCCATTACCAAGGCTGCTGG + Intronic
971094538 4:23385787-23385809 GTGATCAATTCCAATGCTGGAGG + Intergenic
974181695 4:58391996-58392018 GTTACTAATACGTAGGCTGCAGG - Intergenic
980104356 4:128573448-128573470 GTGAGCAAAACAAAAGCTGCTGG + Intergenic
980562362 4:134493929-134493951 GTGATTAATATCAAGGATGCAGG + Intergenic
983023065 4:162703138-162703160 TTGAACAAGACCAAAGCTGCAGG + Intergenic
992067271 5:73120077-73120099 GTGGCCAAGGCCAAGGCGGCCGG + Intergenic
992985442 5:82224314-82224336 GTCACAAATACCCAGGCTTCAGG + Intronic
1003002003 6:2344905-2344927 GTGCCCAATACACTGGCTGCTGG + Intergenic
1005454679 6:26007685-26007707 ATGACCAATACCCATGGTGCAGG - Intergenic
1011783916 6:90822533-90822555 GTTGCCTATACCAAGGCTGTAGG - Intergenic
1015601703 6:134916881-134916903 GTGTCCAAAGCCGAGGCTGCTGG - Intergenic
1016997435 6:149970360-149970382 GGGACCCATACCAAGGCTCAAGG + Intronic
1019076308 6:169390686-169390708 CTCAAAAATACCAAGGCTGCTGG + Intergenic
1020207309 7:6129105-6129127 GTGACCACTAAAAAGGCTACAGG - Intronic
1020610875 7:10396327-10396349 GAGACAACTACCAAGGCTGGTGG - Intergenic
1024048596 7:45601969-45601991 GTGACCAGTGCCAGGGCTTCAGG + Intronic
1042725811 8:71875475-71875497 GTAACCAGTAACAAGACTGCTGG + Intronic
1045945320 8:107788904-107788926 GCTACCACTACCAAGGCTTCGGG + Intergenic
1049770178 8:144376406-144376428 GTGAGCATGAGCAAGGCTGCTGG + Intronic
1050413373 9:5389213-5389235 GTGAAAAATAGTAAGGCTGCAGG + Intronic
1051718990 9:20015849-20015871 GTCACCAATTCCAAGGCAACAGG + Intergenic
1052085848 9:24264612-24264634 ATGACCAATACCAAGTCTTGGGG - Intergenic
1052817278 9:33111541-33111563 TTAACCAATACAAAGGCTTCTGG + Exonic
1058710351 9:107673620-107673642 GTGTAAAATCCCAAGGCTGCTGG - Intergenic
1061894293 9:133639070-133639092 GGGAACAATGCCTAGGCTGCAGG + Intronic
1062750616 9:138249463-138249485 GTGGACAATCCCAGGGCTGCCGG + Intergenic
1199253005 X:145686161-145686183 GTGAGAAATTCCAAGCCTGCAGG + Intergenic
1199297205 X:146172759-146172781 GGGACCAATGCCAAGGCCACAGG + Intergenic