ID: 1152089047

View in Genome Browser
Species Human (GRCh38)
Location 17:78237040-78237062
Sequence GCTCCCAGGCACAATGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 208}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152089047_1152089062 11 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089062 17:78237074-78237096 CTAGGGGGTGGAGGGGCCGGAGG 0: 1
1: 0
2: 1
3: 59
4: 645
1152089047_1152089061 8 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089061 17:78237071-78237093 CGGCTAGGGGGTGGAGGGGCCGG 0: 1
1: 0
2: 1
3: 53
4: 708
1152089047_1152089056 -1 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089056 17:78237062-78237084 CGAAGGCACCGGCTAGGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1152089047_1152089052 -7 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089052 17:78237056-78237078 TGGGAGCGAAGGCACCGGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 115
1152089047_1152089066 26 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089066 17:78237089-78237111 GCCGGAGGTAGCTGGTGGATGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1152089047_1152089053 -6 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089053 17:78237057-78237079 GGGAGCGAAGGCACCGGCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 83
1152089047_1152089057 2 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089057 17:78237065-78237087 AGGCACCGGCTAGGGGGTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 343
1152089047_1152089059 4 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089059 17:78237067-78237089 GCACCGGCTAGGGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 27
4: 213
1152089047_1152089064 21 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089064 17:78237084-78237106 GAGGGGCCGGAGGTAGCTGGTGG 0: 1
1: 0
2: 2
3: 39
4: 488
1152089047_1152089055 -4 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089055 17:78237059-78237081 GAGCGAAGGCACCGGCTAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 68
1152089047_1152089054 -5 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089054 17:78237058-78237080 GGAGCGAAGGCACCGGCTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1152089047_1152089063 18 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089063 17:78237081-78237103 GTGGAGGGGCCGGAGGTAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 450
1152089047_1152089068 29 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089068 17:78237092-78237114 GGAGGTAGCTGGTGGATGGGTGG 0: 1
1: 1
2: 2
3: 58
4: 559
1152089047_1152089065 25 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089065 17:78237088-78237110 GGCCGGAGGTAGCTGGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 289
1152089047_1152089058 3 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089058 17:78237066-78237088 GGCACCGGCTAGGGGGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 230
1152089047_1152089069 30 Left 1152089047 17:78237040-78237062 CCCTCTGCATTGTGCCTGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1152089069 17:78237093-78237115 GAGGTAGCTGGTGGATGGGTGGG 0: 1
1: 0
2: 2
3: 33
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152089047 Original CRISPR GCTCCCAGGCACAATGCAGA GGG (reversed) Intronic
900150324 1:1175997-1176019 GCTCCCAGCCACTGTGCAGGTGG + Intronic
900524038 1:3119854-3119876 TCTCCCCCGCACACTGCAGATGG - Intronic
900652407 1:3736350-3736372 CCTCCGAGGCACAGGGCAGAGGG - Intergenic
900666166 1:3816917-3816939 GCTCCCTGTCCCCATGCAGACGG - Intronic
901415698 1:9114525-9114547 CCTCCCAGGCCCAACTCAGAGGG - Intronic
903536043 1:24066979-24067001 GCCCCCAGGCCCAGTGCAGGGGG - Intronic
903686353 1:25135036-25135058 GCTGTCAGGCTCAAGGCAGATGG + Intergenic
904339313 1:29823829-29823851 ACTCCTGGGCTCAATGCAGATGG + Intergenic
904380092 1:30104783-30104805 GGTCCCAGGCACACAGCAGGAGG + Intergenic
905657633 1:39695297-39695319 TCTCCCAGCCACAAAGAAGATGG - Intronic
905847440 1:41244120-41244142 TGTCCCAGGGACTATGCAGAAGG + Intergenic
907294536 1:53441341-53441363 CCTCCCAGGCACATGGCAGCAGG + Intergenic
907457715 1:54586061-54586083 GCCCCCAGAAACACTGCAGAGGG - Intronic
907537751 1:55180365-55180387 GAACCCAGGCTAAATGCAGAGGG + Intronic
908207748 1:61868855-61868877 TCTCCCAGGCACAAAATAGAGGG - Intronic
909911501 1:81263378-81263400 CCCCCCAGGCACAACACAGAGGG + Intergenic
910629831 1:89343266-89343288 GTTTCCAGACACAATGAAGATGG - Intergenic
912171101 1:107100567-107100589 GATCCCAGGCACCATGCCAAGGG + Intergenic
912746269 1:112248135-112248157 GCCCTTAGGCAGAATGCAGAAGG - Intergenic
913685496 1:121228068-121228090 ACTCCCAAGCACAAGGCAAATGG - Intronic
914037341 1:144015672-144015694 ACTCCCAAGCACAAGGCAAATGG - Intergenic
914152112 1:145052260-145052282 ACTCCCAAGCACAAGGCAAATGG + Intronic
917047195 1:170874287-170874309 TCTCCCAGGCTGAATGCAGTGGG + Intergenic
919136948 1:193521110-193521132 ACTCCCAGTCACACTGCACATGG + Intergenic
920192286 1:204201388-204201410 GCTCACAGGCACAGTGCTGGGGG + Intronic
920472814 1:206246626-206246648 ACTCCCAAGCACAAGGCAAATGG - Intronic
921027520 1:211300370-211300392 GCTCCGTGGAAAAATGCAGAAGG - Intronic
921463511 1:215457592-215457614 GGTCACAGTCAAAATGCAGATGG - Intergenic
921824885 1:219661231-219661253 GCTCCCATGTACACGGCAGAGGG - Intergenic
922825693 1:228516637-228516659 GCTCCCAGGCCCAGAACAGATGG - Intergenic
922933675 1:229408498-229408520 GCTTCCAGGCAGAATGAAGAAGG - Intergenic
1065645636 10:27831129-27831151 GCATCCAAGCACAAGGCAGATGG - Intronic
1066336099 10:34480068-34480090 CCTTGCAGGCACAAGGCAGACGG + Intronic
1067063383 10:43089641-43089663 GCTCCCCGACACAATGCTGTCGG - Intronic
1067288350 10:44923783-44923805 CTTCCCAGGCATAAAGCAGAAGG - Intronic
1067805665 10:49391316-49391338 GCCCCCAGACACAGTTCAGAGGG + Intronic
1070325375 10:75385248-75385270 GCTCCCAGCCACACAGAAGAGGG - Intergenic
1072048706 10:91682290-91682312 GTTCCATGGCACAATGCAAAGGG - Intergenic
1072188245 10:93061675-93061697 ACTCCCAGACACAACGCAGGGGG + Intronic
1072540433 10:96394312-96394334 GCGCCCAGGCCCAATGCAGTGGG + Intronic
1073137167 10:101226507-101226529 GCTCTTAGGGACAATGCAGGGGG - Exonic
1074290051 10:112131593-112131615 GCTCCCAGACAGAAGGCAGGTGG - Intergenic
1074467809 10:113698877-113698899 GCTCCCAGGCAGTATTCAGGAGG + Intronic
1077062775 11:625143-625165 GCACCGAGGCACAGGGCAGAAGG + Exonic
1077587933 11:3468535-3468557 TCTCCCTGGCACAAAGCACAGGG + Intergenic
1083325133 11:61869318-61869340 GGTCACAGGCACAGGGCAGAGGG - Intergenic
1083640211 11:64141374-64141396 GCTCCCCGGCTCTGTGCAGATGG - Intronic
1084243629 11:67840178-67840200 TCTCCCTGGCACAAAGCACAGGG + Intergenic
1087836415 11:102879667-102879689 GATGCCAGGGACTATGCAGAGGG + Intergenic
1088950137 11:114560377-114560399 GCCCCTAGGCCCAAGGCAGAAGG - Intergenic
1089974875 11:122723751-122723773 GCTCCAAAACACAATGCACATGG - Intronic
1090074420 11:123571015-123571037 GCAGCCAGGCGCACTGCAGAGGG + Intronic
1090241223 11:125183153-125183175 GCTCCAAGGGACAAGGCACATGG + Intronic
1091218361 11:133917199-133917221 GTGCCCAGGCACAGGGCAGAGGG + Intronic
1091596824 12:1883976-1883998 GCTCCCAGACAAAAAGCAGAGGG - Intronic
1096694886 12:53342308-53342330 GCTCCGAGGAAGAATGCAGCAGG - Intronic
1098618210 12:72556585-72556607 GCTGCCAGGCAAAGTGGAGAGGG + Intronic
1101041271 12:100758303-100758325 GCTCCCAGGCACCAGTCACATGG - Intronic
1102044816 12:109823122-109823144 GCTCCCAGGCACTTGGCAGGCGG + Intronic
1103377044 12:120465047-120465069 ACTCCCATGCAATATGCAGAAGG + Intronic
1104976872 12:132556060-132556082 GCTCCCAGGGAAAGTGCAGAAGG - Intronic
1108125103 13:47233970-47233992 CCTACAAGGCAAAATGCAGATGG - Intergenic
1108257349 13:48623449-48623471 GCTCCCTGGCCCAATCCTGAGGG - Intergenic
1110896099 13:80754420-80754442 TCTCTCAGGCACATTGCAGTTGG - Intergenic
1113645114 13:111989369-111989391 GATCTCAGGCAGAAGGCAGAAGG - Intergenic
1118650515 14:67887885-67887907 ACTCCCTGACACACTGCAGATGG - Intronic
1118845087 14:69541958-69541980 ACTTCCAGGCACAATGGAAAGGG - Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121713695 14:96057789-96057811 CCTTCCAGGTACAATGCAGGAGG - Intronic
1121968333 14:98331304-98331326 CCACCCAGGCACAACCCAGAGGG - Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1125707310 15:41750362-41750384 TCTCCTAGGAACAATGGAGAAGG - Exonic
1126161402 15:45617013-45617035 GCTCCCAGGCAGACTGCATAGGG - Intronic
1127847507 15:62884067-62884089 CCTCCCAGGCCTAAAGCAGATGG - Intergenic
1130369828 15:83275713-83275735 GCTCTCAGGCACAATAGAGATGG + Intronic
1136737488 16:32477096-32477118 GCTCCCAGGCCGAAGGCAGCAGG + Intergenic
1137651738 16:50126326-50126348 TCTCCTAGGCACAAAGCAGAAGG + Intergenic
1139369945 16:66460751-66460773 GCTACCAGGCACCATGCACTGGG - Intronic
1140944787 16:79757858-79757880 GTTCACAGGCACAGTGCAAATGG - Intergenic
1203015583 16_KI270728v1_random:352481-352503 GCTCCCAGGCCGAAGGCAGCAGG - Intergenic
1203033918 16_KI270728v1_random:625639-625661 GCTCCCAGGCCGAAGGCAGCAGG - Intergenic
1144671770 17:17136838-17136860 GGGCCCAGGCAGAATGCGGATGG - Intronic
1144833759 17:18145895-18145917 TCTCCCGGGCACCATGCAGGTGG - Exonic
1145037413 17:19551102-19551124 GGCCCCAGGCACACTCCAGATGG - Intronic
1146257354 17:31399172-31399194 GCCACCAGGAACAGTGCAGAAGG + Intronic
1149230383 17:54526987-54527009 GATGCCAGGCACAATCCTGAAGG + Intergenic
1150512756 17:65774301-65774323 TCTCCCAGGCTTAATGGAGAAGG - Intronic
1151936369 17:77264393-77264415 GCTCCCAGACACCAGGCTGAGGG - Intergenic
1152089047 17:78237040-78237062 GCTCCCAGGCACAATGCAGAGGG - Intronic
1152367573 17:79865487-79865509 GCTTCCATGCCCACTGCAGAGGG + Intergenic
1152746792 17:82044025-82044047 GCGCCCAGGCACAGGGCACATGG - Intergenic
1153218292 18:2840056-2840078 GCTCCCAGGCATAGTGCTGAAGG + Intergenic
1153519925 18:5941967-5941989 CTCCCCAGGCACAAGGCAGATGG + Intergenic
1156126905 18:33917025-33917047 CAACCCAGGCACTATGCAGAAGG + Intronic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1158201557 18:54947313-54947335 GCTCCCAGGGAGGAGGCAGAGGG + Intronic
1160534062 18:79581914-79581936 GCTCACATGCACAGTGCACACGG + Intergenic
1162796864 19:13091646-13091668 CCTCCCTGGCACAGAGCAGAGGG - Intronic
1164825758 19:31283888-31283910 GTTCCCAGTCACTGTGCAGATGG + Intronic
1165174783 19:33920520-33920542 GATCCCAGGAAGAATGTAGATGG + Intergenic
1167645685 19:50703765-50703787 GCCCCCAGGCACAGGGCTGACGG - Exonic
1168571800 19:57476752-57476774 GCTCCCAGGCACATTGTAACTGG - Intronic
1168591590 19:57640489-57640511 CCTCCCAGGTACAGTGCACAAGG - Intronic
924960218 2:28040-28062 GCTGCCAGGCACAATTCATTGGG + Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
927249242 2:20983048-20983070 GCTTCCAGCCACACTTCAGATGG - Intergenic
932885903 2:75549113-75549135 GCACCCTGCCACAATCCAGAAGG + Intronic
933358478 2:81245959-81245981 CCTGCCAGGCACACTGCACATGG + Intergenic
933671046 2:85007528-85007550 GCTCCCAGGAACAGGTCAGAGGG + Intronic
935698522 2:105790454-105790476 GCTCCCAGGCTGCCTGCAGAGGG - Intronic
937198253 2:120179667-120179689 TCTCCCAGGCAGAAAACAGAGGG - Intergenic
937911147 2:127076130-127076152 GCTCCCAGGCCAATTGGAGATGG + Intronic
941281154 2:163552901-163552923 GTTCCAAGGCATAAGGCAGAGGG - Intergenic
942078808 2:172381525-172381547 ACTCACAGGCAAGATGCAGATGG - Intergenic
943179463 2:184524714-184524736 GCTCCCAGGCAAAAAGGAGTAGG - Intergenic
944149949 2:196547307-196547329 GCACTCAGGCACAATTCAGATGG + Intronic
944329427 2:198447801-198447823 ATTCCCAGGCACAATGAAGCAGG - Intronic
944920212 2:204404801-204404823 CCTCCAATGCACAAGGCAGACGG - Intergenic
946686733 2:222278521-222278543 GCTCCCTGGCAAAAAGCAGAAGG - Intronic
947579644 2:231307091-231307113 GTTCCCAGGCAAAATTGAGATGG - Intronic
947717995 2:232351457-232351479 GCTCCCGGGCACCATGAGGAGGG + Intergenic
948768518 2:240235549-240235571 GCTCCCAGGCAGGTTGCAGCTGG - Intergenic
948926961 2:241105398-241105420 GCTCCCAGGCAGCTTCCAGAGGG + Intergenic
1168798464 20:628223-628245 GCTGCCTGCCTCAATGCAGATGG - Intergenic
1168960714 20:1867604-1867626 GGTCCCAGGCTCTATGCAGGAGG + Intergenic
1172929940 20:38579397-38579419 GCTCCCAGGCACAGTTCAGAGGG - Intergenic
1173349414 20:42231353-42231375 GCTCACAGCCAGAATGCAGCAGG - Intronic
1175942208 20:62542663-62542685 CCTCCCAGGCACGGTGCAGGAGG + Intergenic
1177727868 21:24992070-24992092 GCCTCCAAGCACAATGGAGATGG - Intergenic
1178844946 21:36166815-36166837 GCTATCAGGCACGCTGCAGATGG + Intronic
1179268225 21:39824704-39824726 GCTACCAAGAACAATGCAGCAGG - Intergenic
1179940757 21:44637878-44637900 GCACACAGGCACATAGCAGACGG - Exonic
1180262116 21:46678908-46678930 GCTGCCAGGCACAATTCATTGGG - Intergenic
1182002390 22:26930673-26930695 GTTCCCAGGCACTATGCTAAGGG - Intergenic
1183198632 22:36370698-36370720 GCTCACAGGCACTGGGCAGAAGG + Intronic
1184793535 22:46717283-46717305 GCACCCAGGAGAAATGCAGACGG + Intronic
950964382 3:17136248-17136270 GCTCGCAGGCATTATGAAGAGGG - Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952834306 3:37590767-37590789 GCTCCCAGGCACAGAGATGAGGG + Intronic
954399961 3:50314198-50314220 GCTCCCAGGCTCAAAGCACTGGG - Intergenic
956054660 3:65285942-65285964 GCTACCAGGCAAAATTCAGGGGG + Intergenic
956060226 3:65341399-65341421 GCTGCCAGATACAATGCAGGAGG + Intergenic
956431887 3:69195117-69195139 GCTCACAGGCAAAATGCCAAAGG - Exonic
956657347 3:71565285-71565307 GATACCAGGCACACTGCAGCAGG + Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
961891724 3:130135907-130135929 CCTCCCTGGCACAAAGCACAGGG + Intergenic
963762003 3:149293911-149293933 GTCTCCAGGCACAATGAAGATGG - Intergenic
965073985 3:163953490-163953512 GCTCTCAGGCAAAATGGGGAGGG - Intergenic
965883051 3:173410388-173410410 GGTGCTAGGCACAATGGAGAAGG + Intronic
966881732 3:184354561-184354583 GCCCCCAGGCACAATCCGGTAGG + Exonic
968108000 3:196016129-196016151 GCTGCCAGGCACAATTCATTGGG + Intergenic
969126317 4:4951008-4951030 CCTCCCAGACACAGTGCTGAGGG - Intergenic
970544674 4:17115335-17115357 GCTGCTAGGCCCAATGCAGAGGG - Intergenic
976781260 4:88761225-88761247 GCCCCCAGACACCATGCTGAAGG - Intronic
978927004 4:114258899-114258921 GCTACCAGGCATCATGCATAAGG + Intergenic
980119876 4:128716632-128716654 GCACCCAGGCACAGTGTACAGGG + Intergenic
984257495 4:177406133-177406155 GCTTCCAGGCATAAGGAAGATGG - Intergenic
984771071 4:183436574-183436596 GCTCCCCAGCACAGTGCAGTAGG + Intergenic
985469937 5:34196-34218 GCTGCCAGGCACAATTCATTGGG + Intergenic
985748305 5:1660180-1660202 GGTCACAGGCACAAGGCAGCTGG - Intergenic
986308414 5:6532674-6532696 ACTCCCAGGCACCAGGCAGGAGG - Intergenic
986468592 5:8051349-8051371 GCACCAGGGCAGAATGCAGAAGG - Intergenic
987424918 5:17762266-17762288 GCTGCAGGGGACAATGCAGAAGG + Intergenic
988658836 5:33242136-33242158 GGTCCCAGGCAGCGTGCAGAAGG - Intergenic
993386135 5:87265890-87265912 ACTCCCAGGCAACATACAGAGGG + Intergenic
995564814 5:113423220-113423242 GCCCCCAAGCACAGTGCTGAAGG + Intronic
996770207 5:127077744-127077766 CCTGCCAGGCACAAAGAAGAAGG + Intergenic
998177386 5:139910328-139910350 GCAGCCAGGCACAATTCTGAGGG - Intronic
1000432496 5:161167180-161167202 GCTCCCAGGGAGATTGCTGAGGG + Intergenic
1001648720 5:173300607-173300629 GCTCTCAGGCACAGTGTAGGAGG + Intergenic
1002528538 5:179829336-179829358 ACCCCCAGGCACCCTGCAGAGGG + Intronic
1003128376 6:3374290-3374312 CCTCCCTGGCACCATGCACATGG + Intronic
1005944476 6:30585422-30585444 ACTCACAGGCACAGTGGAGAAGG - Intronic
1006466288 6:34196717-34196739 GCTCCCTTTCACAATGCAGGAGG - Intergenic
1007597175 6:43058541-43058563 ATTCCCAGAAACAATGCAGAGGG - Intronic
1007719013 6:43874465-43874487 GTGCCCAGGAACAATGAAGAAGG + Intergenic
1007754461 6:44090031-44090053 GCTCCCAGGGAAACTGGAGAGGG + Intergenic
1011850319 6:91619582-91619604 GCTCTAAGGAACAATGCAGGTGG + Intergenic
1012454806 6:99392210-99392232 CCTACCAGGCACCATGCTGATGG + Intronic
1015513078 6:134058871-134058893 GCTCCCAGGGCCATGGCAGAGGG + Intergenic
1015880477 6:137866649-137866671 GCTGGCAGGAACAATGGAGATGG + Intergenic
1016119317 6:140327889-140327911 GTTTCCAAGCACAATGGAGATGG + Intergenic
1016131694 6:140481131-140481153 GCTTCCATGGGCAATGCAGATGG + Intergenic
1017031797 6:150230363-150230385 GCCCCCAGGCCCAGGGCAGATGG + Intronic
1017056398 6:150440285-150440307 GTTCCCAGGCACCATTAAGAAGG + Intergenic
1019369399 7:653045-653067 GCGCCCAGCCACCATGCAGTGGG - Intronic
1022543693 7:31164925-31164947 GCTTCCAGGCACAACTCACAGGG + Intergenic
1022800395 7:33771412-33771434 GGTCCCAGGCAGAAGACAGAGGG - Intergenic
1026659263 7:72284957-72284979 GGACCCAGGCACATTGCAGTAGG + Intronic
1029129228 7:98317604-98317626 GGTCCCAGCCAGCATGCAGACGG - Intronic
1029129273 7:98317845-98317867 GGTCCCAGCCATCATGCAGATGG - Intronic
1029129279 7:98317886-98317908 GGTCCCAGCCAGCATGCAGATGG - Intronic
1029129306 7:98318006-98318028 GGTCCCAGCCATCATGCAGATGG - Intronic
1029129312 7:98318047-98318069 GGTCCCAGCCAGCATGCAGATGG - Intronic
1029199297 7:98827881-98827903 CCTCTCAGGCACAAAGCACAGGG + Intergenic
1029856665 7:103524251-103524273 GTTCCCAAGCCAAATGCAGAGGG - Intronic
1030487048 7:110182663-110182685 TCTCCCAGGCCAAATGCAGTGGG + Intergenic
1032410091 7:131688514-131688536 GCTCCCCGGCACGGAGCAGAGGG - Intergenic
1034211106 7:149364041-149364063 GTTCACAGGCAAAAGGCAGAAGG - Intergenic
1035028061 7:155839303-155839325 GCTCCAAGTCATAGTGCAGATGG + Intergenic
1035034307 7:155885210-155885232 TGTCCCAGGAAGAATGCAGATGG + Intergenic
1036374113 8:8185578-8185600 TCTCCCTGGCACAAAGCACAGGG - Intergenic
1036876790 8:12480061-12480083 TCTCCCTGGCACAAAGCACAGGG + Intergenic
1038215865 8:25561316-25561338 GATCCGAGACACAATGCAAAAGG - Intergenic
1038361520 8:26884136-26884158 TCTCCTACGCACAATGCTGAAGG - Intergenic
1043162523 8:76863545-76863567 GCTCCCTGGAACAGTGCAGGGGG + Exonic
1047424156 8:124730169-124730191 TGTCCCAGGCACATTGCTGAGGG + Intergenic
1047433086 8:124809479-124809501 GGTCCCTGACACAAGGCAGAAGG + Intergenic
1049195519 8:141313685-141313707 GCCCCAAGGCAAAATGAAGAGGG + Intergenic
1055685450 9:78768823-78768845 GCTATCGGGCACAAGGCAGAAGG - Intergenic
1056501705 9:87216029-87216051 GGACCAAGGCACACTGCAGAAGG + Intergenic
1056763133 9:89428628-89428650 GCTCCCAGCCACTCTGCACACGG + Intronic
1057125469 9:92612810-92612832 CCTCCCAGGCTGAATGCACAGGG + Intronic
1057533370 9:95875065-95875087 GCTCCCGGGCTCAGTGCAGACGG + Intergenic
1059407800 9:114112698-114112720 GCTCCCAGCCCCAATCCAGCAGG - Intergenic
1061509261 9:131050414-131050436 GCTCGTAGGCAGAATACAGAAGG - Intronic
1061899477 9:133665712-133665734 GCTCGCAGGCCCAATGGGGAGGG - Intronic
1185918646 X:4064154-4064176 GGTCCCAGCCACAATGCAACAGG - Intergenic
1187018040 X:15350155-15350177 GCTCACAGGGGCAAAGCAGAAGG - Intronic
1188497302 X:30793943-30793965 GGTGCAAGGCACAAGGCAGAAGG - Intergenic
1189548294 X:42066789-42066811 GCTCCCAGGTCCAATGCGGAAGG - Intergenic
1195582301 X:106519671-106519693 TCTCCCAGGCATAAAGCAAATGG - Intergenic
1198753224 X:139956020-139956042 GATTCCAGGAACAATGCATACGG - Exonic