ID: 1152089283

View in Genome Browser
Species Human (GRCh38)
Location 17:78237996-78238018
Sequence TTTGGCTGGGCAGTGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152089277_1152089283 9 Left 1152089277 17:78237964-78237986 CCCTGAATGTCAGCTTGGGTCAG 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089272_1152089283 29 Left 1152089272 17:78237944-78237966 CCAGTGAGATCCAGACCTGGCCC 0: 1
1: 1
2: 1
3: 20
4: 186
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089274_1152089283 14 Left 1152089274 17:78237959-78237981 CCTGGCCCTGAATGTCAGCTTGG 0: 1
1: 0
2: 3
3: 19
4: 204
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089278_1152089283 8 Left 1152089278 17:78237965-78237987 CCTGAATGTCAGCTTGGGTCAGT 0: 1
1: 0
2: 1
3: 15
4: 118
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089273_1152089283 19 Left 1152089273 17:78237954-78237976 CCAGACCTGGCCCTGAATGTCAG 0: 1
1: 0
2: 1
3: 18
4: 284
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152089283 Original CRISPR TTTGGCTGGGCAGTGCCCAG AGG Intronic
900038806 1:439898-439920 CAGGGCTGGGCAGTGCCTAGAGG - Intergenic
900060239 1:674874-674896 CAGGGCTGGGCAGTGCCTAGAGG - Intergenic
900090321 1:917370-917392 CTTGCCTGGGCTGGGCCCAGGGG + Intergenic
900572431 1:3365172-3365194 TGGAGCTTGGCAGTGCCCAGGGG + Intronic
900906386 1:5562637-5562659 TTCCACTAGGCAGTGCCCAGTGG + Intergenic
901532968 1:9864939-9864961 TGTGGCTGGGCTGGGCGCAGTGG + Intronic
901647533 1:10724709-10724731 TCTGGCTGGGCAGTGCCCTTGGG - Intronic
902202782 1:14846030-14846052 GTTTGCTGGGAAGAGCCCAGGGG + Intronic
902826524 1:18978467-18978489 TGGGGTAGGGCAGTGCCCAGGGG - Intergenic
904194787 1:28777077-28777099 TTTGGCTAGGCCGGGCGCAGTGG + Intergenic
904287152 1:29460152-29460174 TGTGGCTGGTGAGTGGCCAGAGG + Intergenic
904997305 1:34641005-34641027 TTTTGCTCTGCAGTGCCCTGAGG - Intergenic
905012333 1:34755766-34755788 TAAGGCTGGGCAGTTCCCGGAGG + Intronic
905016227 1:34780758-34780780 TGGGGCTGGGCTGTGCCCTGGGG - Intronic
906003029 1:42443580-42443602 TGTGGCTGTGAGGTGCCCAGGGG + Intronic
906713953 1:47953131-47953153 TTGGGCTGGGCAGTCCTCTGTGG - Intronic
907652014 1:56304100-56304122 TATGGCAGGCCAGTGTCCAGAGG + Intergenic
908746806 1:67384076-67384098 TTCCACTAGGCAGTGCCCAGTGG + Intronic
910133588 1:83939104-83939126 TTTGTATCCGCAGTGCCCAGCGG - Intronic
911398200 1:97338460-97338482 TGTGGCTGGGCAGTCTCCAGTGG - Intronic
911872086 1:103110813-103110835 CCTAGCTGGGCAGTGGCCAGAGG - Intergenic
912500663 1:110120010-110120032 TGTGGCAGGGGAGTGGCCAGAGG + Intergenic
912658332 1:111507428-111507450 TGTGGTTGAGCTGTGCCCAGTGG - Intronic
912680974 1:111728873-111728895 GATGGCTGGGCAGTGGGCAGTGG + Intronic
912745601 1:112243211-112243233 TTTTGCTGGGGAGTGGGCAGGGG - Intergenic
913084792 1:115426620-115426642 CCTGGCAGGGCAGTGGCCAGAGG - Intergenic
913526864 1:119701937-119701959 CTTCACTAGGCAGTGCCCAGTGG - Intronic
914703630 1:150154346-150154368 TTGGGCTGGAAAGTGGCCAGAGG - Intronic
914937696 1:151994419-151994441 TTTGGCTTGTCAGCACCCAGGGG + Intergenic
916213511 1:162376978-162377000 TTTGACTTGCCATTGCCCAGTGG + Intronic
919633267 1:199979761-199979783 TTTGACTAGGCAGGGCGCAGTGG - Intergenic
920165668 1:204033966-204033988 TGTGGCTGGGCCGGGCACAGTGG + Intergenic
923025057 1:230197360-230197382 CTCGCCTGGGCAGTGCCCACAGG + Intronic
923114276 1:230919963-230919985 GTAGGCTGGGGAGTGCTCAGGGG - Intronic
1063523819 10:6764721-6764743 CTTGGCTGGGCCGGGTCCAGGGG - Intergenic
1067448228 10:46366065-46366087 CTTGGCTGGCCAGTCACCAGAGG - Intergenic
1067589149 10:47494701-47494723 CTTGGCTGGCCAGTCACCAGAGG + Intergenic
1067636274 10:48002792-48002814 CTTGGCTGGCCAGTCACCAGAGG + Intergenic
1069040119 10:63687157-63687179 TTTGGTTGGGCAGTGGGCAGTGG - Intergenic
1069398754 10:68019281-68019303 TTTGGCTGGACCGGGCGCAGTGG - Intronic
1069457658 10:68565847-68565869 TTTGGCTGGGTGGCACCCAGTGG + Intronic
1069662846 10:70135103-70135125 TTTGCCTGAGCAGTGCCCTCTGG - Intergenic
1069976139 10:72214889-72214911 TTTTGTTGGGCAGTGGCCTGTGG - Intronic
1070132835 10:73666797-73666819 CTTGGCTGGCCAGTCACCAGAGG + Intergenic
1070398229 10:76031480-76031502 TTTGGCTGAACAGTGCTCAGTGG + Intronic
1071608844 10:87017277-87017299 CTTGGCTGGCCAGTCACCAGAGG - Intergenic
1074418149 10:113285318-113285340 GCTGGCTGGGCAGTGATCAGCGG - Intergenic
1075481950 10:122789680-122789702 AGAGGCTGGGCAGGGCCCAGGGG - Intergenic
1075690093 10:124388770-124388792 CCTGGCTGGGCTGTGCCCGGAGG - Intergenic
1076559404 10:131351305-131351327 TCTGGCTGGGCAGTGGCCTTTGG + Intergenic
1076965014 11:75809-75831 CAGGGCTGGGCAGTGCCTAGAGG - Intergenic
1077226993 11:1442877-1442899 CTCGGCTGGGCAGGGGCCAGGGG - Intronic
1077315241 11:1916751-1916773 TGTGGCTGGGTAGAGCTCAGAGG - Intergenic
1078566342 11:12417863-12417885 TCTAGCTGGGCAGCTCCCAGGGG + Intronic
1080684243 11:34502374-34502396 GTTGGCTGAGCAGTGCCCAGAGG + Intronic
1082080064 11:48005994-48006016 CTTGGCTGGGAGGGGCCCAGAGG + Intronic
1083293781 11:61704405-61704427 TTTGGTCGGGCAGGGCACAGTGG - Intronic
1083624337 11:64064424-64064446 ATTGCCTGCCCAGTGCCCAGAGG - Intronic
1083876977 11:65529400-65529422 CATGGGAGGGCAGTGCCCAGGGG + Intronic
1084159333 11:67337006-67337028 TTTGGGGGGGCAGTGGTCAGAGG + Intronic
1084253670 11:67923003-67923025 TTTGGCTGGACAATCCCCAAGGG - Intergenic
1088787861 11:113199054-113199076 TTGGGCTGGGCAGGACCCAGGGG - Intronic
1089479886 11:118795967-118795989 TGTGGCTGGGCCGGGCACAGTGG + Intergenic
1090372911 11:126269071-126269093 TTGGGCGGGGCAGAGCCCTGAGG + Intronic
1090445472 11:126761263-126761285 TTTGCCTGGGCAGAGTGCAGGGG - Intronic
1090765777 11:129874760-129874782 TCTGGTCGGACAGTGCCCAGAGG + Intronic
1091798142 12:3308948-3308970 GAGGGGTGGGCAGTGCCCAGGGG - Intergenic
1092981952 12:13804561-13804583 TTTGCCTTGTCAGTGCCCAAGGG + Intronic
1094604098 12:31935826-31935848 ATTGGCTGGGCACAGCACAGTGG - Intergenic
1096081592 12:48836853-48836875 GGTGGCTGGACAGAGCCCAGAGG - Intronic
1097302600 12:58034618-58034640 TTTTCCTGGGCAGTAGCCAGGGG - Intergenic
1101442290 12:104712838-104712860 TTTGGCTGGGTAGTTCTCATAGG + Intronic
1107181545 13:37467046-37467068 ATTGGCTGGGAGGAGCCCAGAGG - Intergenic
1107811797 13:44207552-44207574 GTTGGCTGGGCAGTGCCTTCTGG + Intergenic
1107958453 13:45539596-45539618 TTGGGCTGGGCAGCCCCCAGGGG - Intronic
1108968492 13:56342026-56342048 TCTTGCTGGGCATTGCCTAGCGG - Intergenic
1113578789 13:111413838-111413860 TGGGGCTGTGCAGTGCCCAGTGG - Intergenic
1114298609 14:21353275-21353297 TTTGGCAGAGCACTGCCCACTGG + Intronic
1116632599 14:47354753-47354775 TTTGGCTGGTTGGTGCCCTGGGG + Intronic
1116903213 14:50381072-50381094 TTAGGCAGAGCAGTGCCCAAGGG - Intronic
1118913048 14:70077815-70077837 TTTGCCTGGGCAGAGTGCAGTGG + Intronic
1119863738 14:77956072-77956094 TTTGGCTGGCTGGTTCCCAGAGG - Intergenic
1121562816 14:94887283-94887305 TCTGGCTTAGCAGTCCCCAGAGG - Intergenic
1122237337 14:100339234-100339256 TTTGGCAGGGCATTGCTGAGAGG + Intronic
1122271685 14:100571104-100571126 TGGGGCTGGACAGCGCCCAGAGG - Intronic
1122706148 14:103623232-103623254 TTTGCCTGGGCTGGGCGCAGTGG - Intronic
1122936157 14:104957281-104957303 TCTGAGTGGGCACTGCCCAGTGG + Intronic
1123063161 14:105603503-105603525 TTTGGCTGGGCTGGGCCAACTGG - Intergenic
1202868797 14_GL000225v1_random:140420-140442 TTTGTCTGGGCTCTGCCCACAGG + Intergenic
1123925706 15:25108382-25108404 TGTGGATGGTCAGTGCCCACAGG + Intergenic
1124031016 15:26012023-26012045 TTTGGACAGGCAGGGCCCAGTGG + Intergenic
1125605614 15:40938284-40938306 ACTGGCAGGGCAGTGCCCAGTGG - Exonic
1125874194 15:43129729-43129751 TTTGGCTAGGCTATGCCAAGAGG - Intronic
1125998049 15:44183135-44183157 TGTTGCTGGGCAGTGCCTTGGGG - Intronic
1126213851 15:46132023-46132045 TTTGGTGGGGCAGTGGCCATGGG + Intergenic
1126609877 15:50518496-50518518 GTTGGCTGGGCTGGGCGCAGTGG - Intronic
1126903771 15:53342613-53342635 TCTGCCTGGGCAGGGCGCAGTGG - Intergenic
1127772757 15:62244191-62244213 TGGGGCGGGGCAGTGACCAGAGG + Intergenic
1127797519 15:62451367-62451389 GTTGGCTGGGCTGGGCACAGTGG + Intronic
1127803067 15:62494175-62494197 TTTGGGTGGGCATAGCCAAGGGG + Intronic
1128262292 15:66240971-66240993 TTTGGCTGGGGAGGGGCCACGGG - Intronic
1128382235 15:67121436-67121458 TCTGGGTGGGCAGCTCCCAGAGG + Intronic
1128694150 15:69747786-69747808 GCTGGCTGGGCAGGGCCCACGGG - Intergenic
1129684617 15:77677934-77677956 CTGGGTTGGGCAGTGCCCTGTGG - Intronic
1130560324 15:84953093-84953115 TTTTCTTGGGCAGTGCCCAGAGG + Intergenic
1130738561 15:86574416-86574438 TTTGACTGGTCAGTCCCAAGGGG + Intronic
1131318103 15:91358628-91358650 TTAGGCTGGGCAGTCCCATGGGG + Intergenic
1132146206 15:99431519-99431541 TCTGGGTGGTCAGTCCCCAGAGG - Intergenic
1132443109 15:101887707-101887729 CAGGGCTGGGCAGTGCCTAGAGG + Intergenic
1132669056 16:1095285-1095307 TGTGGCTGGGCAGAGCCCTGGGG + Intronic
1132782171 16:1633295-1633317 TGTGACTGGGCAGAGCCCTGAGG + Intronic
1133741700 16:8656669-8656691 CTGGGCTGGGCTGTGCCCTGCGG + Intergenic
1135195275 16:20389092-20389114 TTAGGCTGAGCAGTGCCCAGTGG + Intronic
1135304884 16:21359672-21359694 TTGCGCTGGGCTGTGCCAAGGGG + Intergenic
1137676000 16:50304170-50304192 TTTGGCTGGCTAGTCCCCAAGGG + Intronic
1137896461 16:52217818-52217840 TTGGGCTGGGCAGAGGCCAAAGG + Intergenic
1138423352 16:56914194-56914216 TTTGCCTGGGCCGGGCGCAGTGG - Exonic
1138541229 16:57688969-57688991 ATTGGATGGGCAGAGACCAGGGG - Exonic
1139605643 16:68016293-68016315 TTTGTCTAGGCAGTGGCAAGGGG - Intronic
1140322015 16:73961702-73961724 TTAGGCTGGGCCGGGCACAGTGG - Intergenic
1141445189 16:84053323-84053345 TGTGGCTGAGCAGTGTCCTGTGG - Intergenic
1141714736 16:85720302-85720324 TTTGGCTGGGCAGAGCCAGGCGG - Intronic
1142217975 16:88839160-88839182 TGTGGCCGGGCGGTGACCAGCGG - Intronic
1147471226 17:40663526-40663548 TTTGGCAGGGCATTGCCGAAAGG - Intronic
1149983673 17:61331233-61331255 TTTGGCTGGACAGTTGCCAAAGG + Intronic
1151334278 17:73430916-73430938 CTTGTCTGGGCTGAGCCCAGGGG - Intronic
1151820272 17:76493290-76493312 TTTTGCTGGGGATTGCACAGTGG - Intronic
1151980372 17:77504797-77504819 GTTGGGTAGGCAGTCCCCAGAGG - Intergenic
1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG + Intronic
1152583915 17:81180756-81180778 TGGGGCTGAGCAGTGGCCAGAGG - Intergenic
1152623092 17:81375559-81375581 TTTGGCCGGGCCGGGCACAGAGG - Intergenic
1152738245 17:82007893-82007915 TTTGGAAGGGCAGCCCCCAGGGG + Intronic
1152760061 17:82103149-82103171 CTGGGCTGCGCAGTGCCCATGGG + Intronic
1155486365 18:26347205-26347227 CTTGGCTGGGCCGGGCGCAGTGG - Intronic
1157459404 18:47873800-47873822 TGTGGCTGGGGAGTGCCCTTGGG - Intronic
1157764203 18:50285187-50285209 GTTGGGTGGGCAGTGGCCGGCGG + Exonic
1158590201 18:58772640-58772662 TGTGGCTGTGAAGTCCCCAGTGG - Intergenic
1158676411 18:59523275-59523297 AATGGTTGGGCAGAGCCCAGTGG + Intronic
1160641819 19:145439-145461 CAGGGCTGGGCAGTGCCTAGAGG - Intergenic
1161294992 19:3514993-3515015 CTTGGCAGGGCACTGCCCTGTGG - Intronic
1161501359 19:4617847-4617869 ACTGGGTGGGCAGTGGCCAGAGG - Intergenic
1161675597 19:5646689-5646711 AATGGCAGGGCAGTTCCCAGGGG + Intronic
1161708274 19:5832539-5832561 TGTGGCTTGGCCGGGCCCAGGGG + Exonic
1161714518 19:5867697-5867719 TGTGGCTTGGCTGGGCCCAGGGG + Exonic
1164745568 19:30610318-30610340 TCTGGCAGGGCAGTTCCAAGAGG + Intronic
1164994942 19:32714168-32714190 GTTGGCTGGGCTGGGCGCAGTGG + Intergenic
926222672 2:10946491-10946513 CTTGGCTGGGCAGGGCCAACTGG + Intergenic
927939977 2:27097454-27097476 ATTGGCCAGGCAGTGCCCAGCGG + Intronic
929107507 2:38378522-38378544 TTTGGATGGGCCGGGCGCAGTGG - Intergenic
933171609 2:79131720-79131742 ATTGGCTGAGCAGTTCCTAGGGG - Intergenic
935583479 2:104780073-104780095 TTTTTCTGGGCAGAGCCCAAGGG + Intergenic
939645055 2:144687139-144687161 GCTGGCTGGGCAGTAGCCAGGGG + Intergenic
940691630 2:156926309-156926331 TTCCACTAGGCAGTGCCCAGTGG + Intergenic
947714681 2:232333625-232333647 GGAGGCTGGGCAGAGCCCAGGGG - Intronic
1168827481 20:823387-823409 TGGGGCTGGGCAGTGCCCACGGG + Intergenic
1169800197 20:9506483-9506505 CTTGGCTTCGCAGTGCCCGGAGG + Intergenic
1172958271 20:38777988-38778010 TTAAGCTGGGCACTGGCCAGAGG - Intergenic
1172965775 20:38833750-38833772 GTTGGCTTGGCAATGCCCAAAGG - Intronic
1174076631 20:47941996-47942018 GTTGGCTGGAGAGTGGCCAGTGG - Intergenic
1175246664 20:57586262-57586284 GCTGGCTGGGCAGGGCCGAGGGG + Intergenic
1180977374 22:19855652-19855674 TTGGGCTGGGCACGGCCCTGTGG - Intergenic
1182318537 22:29463694-29463716 TTTTGCTGGAGAGAGCCCAGAGG + Intergenic
1182377018 22:29856122-29856144 GGTGGCTGGGCAGGGGCCAGAGG - Intergenic
1183508454 22:38221894-38221916 TTTGGCTGGGGAGCCCCAAGGGG + Intronic
1183605119 22:38863572-38863594 TTGAGGTGGGCAGTGCCCATGGG - Exonic
1183932745 22:41245641-41245663 TGTGTCTGGGCTGTGCCCGGGGG - Exonic
1183988975 22:41585285-41585307 TTTGACTGGGCTGAGACCAGGGG + Intronic
1185143649 22:49117584-49117606 TTGGGTCAGGCAGTGCCCAGAGG - Intergenic
949907618 3:8871835-8871857 TGTGGCTGGCCAGTGGTCAGGGG - Intronic
950252034 3:11473998-11474020 TTTGGCAAGACAGTGGCCAGGGG + Intronic
950648866 3:14394758-14394780 TTTGGCTTGGCTGGGCGCAGTGG + Intergenic
951137900 3:19125524-19125546 TTTGAGAGAGCAGTGCCCAGTGG + Intergenic
952575853 3:34773417-34773439 CTTCACTAGGCAGTGCCCAGTGG - Intergenic
952964514 3:38612847-38612869 TCTGGAGGGGCAGTGCCCAGAGG - Intronic
952991117 3:38831747-38831769 TTTGGCTTGGCTGTGCCCCATGG + Intergenic
953910375 3:46889783-46889805 TGGGGCTGGGCTGTGGCCAGGGG - Intronic
959327228 3:104952697-104952719 CTTGGCTTGGCATTTCCCAGGGG - Intergenic
961406738 3:126685044-126685066 TCTGTTTAGGCAGTGCCCAGTGG + Intergenic
962593569 3:136916011-136916033 TTTGGCTAGGCCGGGCCCAGTGG - Intronic
964267906 3:154921140-154921162 TTCTACTAGGCAGTGCCCAGTGG + Intergenic
968910567 4:3475285-3475307 GCTGCCTGGGCGGTGCCCAGCGG - Intronic
969249634 4:5958461-5958483 AATGGCTGGGCAGTGTCCGGTGG - Exonic
970484527 4:16511132-16511154 TTCGGCTGGTAAGTGGCCAGGGG - Intronic
972215325 4:36891303-36891325 TCAGGCTGTGCAGAGCCCAGGGG - Intergenic
972395232 4:38653481-38653503 ACTGGCTGGGCTGTGCACAGTGG + Intergenic
972793236 4:42392870-42392892 TTTGGGTGGGCACTGCCCTCTGG + Intergenic
975928786 4:79492381-79492403 TTTTCCTGGGCAGAGTCCAGGGG - Intergenic
978871131 4:113579477-113579499 TGTGGCAGGGCAGTGGGCAGAGG - Intronic
980275145 4:130641423-130641445 TTTTGCTGGGAAGTGCCCTTAGG + Intergenic
981624123 4:146737149-146737171 TTTTACTGGGCAGTGACCAATGG + Intronic
982243003 4:153319439-153319461 TTTTGCTGGGCCGGGCACAGTGG + Intronic
982457255 4:155625192-155625214 TTTGGCTGGGCCGTGCACGGTGG + Intergenic
984155959 4:176196353-176196375 TTTTGCTTGGCAGGGCACAGTGG + Intergenic
985752316 5:1687623-1687645 TTTGGCTCTGCAGTGGCCACTGG - Intergenic
985776218 5:1843979-1844001 TTTGGCTGGGCTGGGCACGGTGG - Intergenic
986024720 5:3840043-3840065 TCTGCCTGGGCAATGCCAAGGGG + Intergenic
987309197 5:16666606-16666628 TTTGGCTGGGCATGGCACACTGG + Exonic
987668166 5:20972606-20972628 TTTGTCTGCCCAGTGGCCAGCGG + Intergenic
991463264 5:66882002-66882024 TTTTGCTGGCCAGTGCTCAGAGG + Intronic
992175597 5:74146241-74146263 CTTGGCTGGGACCTGCCCAGTGG + Intergenic
992990073 5:82274747-82274769 TTTGGCTAAGCTGTTCCCAGGGG - Exonic
997198892 5:131997810-131997832 CTTGGCTGGGCAGCAACCAGAGG + Intronic
997299246 5:132790366-132790388 GGAGGCTGGCCAGTGCCCAGCGG - Intronic
998170507 5:139869786-139869808 TTTAGCTGGGCAGGACTCAGAGG + Intronic
999684074 5:154086799-154086821 TCTGGCTGGGTGGGGCCCAGAGG + Intronic
1000659663 5:163921505-163921527 ATTGGCTGGGAAGTGACCATTGG + Intergenic
1001294230 5:170487803-170487825 TGTGACTGGGCCGTGCGCAGTGG - Intronic
1002287922 5:178177653-178177675 TTTGGCTGGGCGGGGCGCAGTGG - Intergenic
1002536616 5:179879499-179879521 CCTGGGTGGGCACTGCCCAGCGG + Intronic
1002735041 5:181379045-181379067 CAGGGCTGGGCAGTGCCTAGAGG + Intergenic
1002749485 6:95077-95099 CAGGGCTGGGCAGTGCCTAGAGG - Intergenic
1002839892 6:896511-896533 TCTTGCTTGGCAGTGCTCAGGGG + Intergenic
1004401061 6:15289037-15289059 TTTGTCTGTGCTGTCCCCAGTGG - Intronic
1004624083 6:17358408-17358430 TTTTGCTGGGCACAGCCCATTGG - Intergenic
1005508193 6:26488724-26488746 CTTGCCTGGGCCGTGCCCAGTGG + Intergenic
1006822722 6:36911200-36911222 TTAGGCTGGGCTGGGCGCAGTGG + Intronic
1010981692 6:82376460-82376482 CTTCACTAGGCAGTGCCCAGTGG + Intergenic
1011630997 6:89324212-89324234 TTTGCCTGGACAGTGCGCAAGGG - Intergenic
1011732352 6:90278336-90278358 CTTGGCTGGGCACTGACGAGTGG - Intronic
1013130370 6:107226956-107226978 TTTGGCTGGGCCGGGCGCGGTGG - Intronic
1015549351 6:134395963-134395985 TTTGTCTGAGCAGGGCACAGAGG - Intergenic
1016666781 6:146651362-146651384 TTTGGCCGCTCACTGCCCAGAGG + Intronic
1018752323 6:166818008-166818030 TTTGGCCGGGCCGGGCGCAGTGG - Intronic
1019239300 6:170651362-170651384 CAGGGCTGGGCAGTGCCTAGAGG + Intergenic
1019323216 7:424954-424976 TTTGGCAGGGCAGGCCCCAGGGG + Intergenic
1019673010 7:2292696-2292718 TTTGCCTGGGCCGGGCACAGTGG - Intronic
1019708953 7:2509721-2509743 AGAGGCTGGGCTGTGCCCAGTGG - Intergenic
1021108885 7:16671641-16671663 TTTGGCTGGGCCAGGCACAGTGG + Intronic
1021214733 7:17901542-17901564 TCTGGCTGGGTTCTGCCCAGTGG + Intronic
1022509339 7:30925323-30925345 TCTGCCTGGGCAATGGCCAGGGG + Exonic
1023557727 7:41440732-41440754 TTTGGCTTTGCAGTGCACATTGG + Intergenic
1025750942 7:64293446-64293468 TTTCCCTGGGCCGTGCCCAGTGG - Intergenic
1026100245 7:67378441-67378463 TGTAGCTTGGCAGTCCCCAGGGG + Intergenic
1026986508 7:74558504-74558526 TTGGGCATGGTAGTGCCCAGTGG - Intronic
1028988257 7:97024354-97024376 TTTGGCTGGGTAGCTCCCGGCGG + Exonic
1029930212 7:104362906-104362928 CTTGCCTGGGTGGTGCCCAGAGG + Intronic
1031374216 7:121004426-121004448 TTAGGCTGGACTCTGCCCAGAGG + Intronic
1033774377 7:144591251-144591273 TTTTGCTGGTCAGTGACCTGGGG + Intronic
1035508470 8:155246-155268 CAGGGCTGGGCAGTGCCTAGAGG - Intergenic
1035577249 8:715665-715687 CTTGGCTGGGGAGTCCACAGGGG + Intronic
1036208859 8:6825878-6825900 CTTTGCTGGGGAGTGGCCAGAGG + Intronic
1037263966 8:17037630-17037652 TTCCACTAGGCAGTGCCCAGTGG - Intronic
1039896275 8:41718946-41718968 TTTCACTGAGCAGTGCCCACAGG - Intronic
1039904006 8:41773150-41773172 TTTGTGTAGGGAGTGCCCAGTGG + Intronic
1041343544 8:56871406-56871428 ATAGGCTGGGCAGGGCGCAGTGG - Intergenic
1042082607 8:65071536-65071558 GTTGGCTGGGCAGGGCGCGGGGG + Intergenic
1044321689 8:90809009-90809031 TTTCACATGGCAGTGCCCAGAGG + Intronic
1044351796 8:91175207-91175229 TAAGGCTGGGCAGAGCTCAGAGG + Intronic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1047415912 8:124664183-124664205 TTCTGCTGGGCTGTTCCCAGGGG + Intronic
1049470128 8:142771541-142771563 TAAGGCTGGGGAGGGCCCAGAGG + Intronic
1049551572 8:143262195-143262217 TTTGGCTGAGCGGTGGCCACGGG - Intronic
1049757960 8:144319143-144319165 TCGGGCTGGGACGTGCCCAGAGG - Intronic
1050559228 9:6817490-6817512 TTTTGCTGGGCTGGGCACAGTGG - Intronic
1050829415 9:9991646-9991668 TTGGGCTGGGCCGGGCACAGTGG - Intronic
1051328306 9:15997328-15997350 GTTGGCTGGGGACTGCCCAGAGG + Intronic
1055070896 9:72164694-72164716 TCTGGCTGGGCCGGGCACAGTGG + Intronic
1056798653 9:89676236-89676258 TGTAGCTTGGCAGTGGCCAGGGG - Intergenic
1058119102 9:101119055-101119077 TTTGGCTGGCCCATTCCCAGGGG - Intronic
1058639444 9:107068692-107068714 TTTAGCTGGGAGGTGCCCACAGG - Intergenic
1059011424 9:110465948-110465970 TTTGGCTGATAAGTGCCCAGTGG + Exonic
1059377710 9:113898842-113898864 CTGCGCTGGGAAGTGCCCAGTGG + Intronic
1059528643 9:115015877-115015899 TTTGGCTGGGAGGTGCAAAGTGG - Intergenic
1060148120 9:121268928-121268950 CTGGTCTGGGCAGTGCCCAGGGG + Intronic
1060192093 9:121599726-121599748 TTTGGGATGGCAGCGCCCAGCGG + Intronic
1062002294 9:134222410-134222432 GCTGGCAGGCCAGTGCCCAGTGG - Intergenic
1062200216 9:135298925-135298947 CTTGGCCGGGCAGTTCCCACAGG + Intergenic
1062511695 9:136909824-136909846 TCAGGCTGGGCAGCGCCGAGGGG - Intronic
1062759508 9:138331653-138331675 CAGGGCTGGGCAGTGCCTAGAGG + Intergenic
1203735982 Un_GL000216v2:139833-139855 TTTGTCTGGGCTCTGCCCACAGG - Intergenic
1203599955 Un_KI270748v1:2425-2447 CAGGGCTGGGCAGTGCCTAGAGG + Intergenic
1190599632 X:52077167-52077189 TTTAGATGAGCAGTGCACAGTGG + Intergenic
1190608564 X:52170683-52170705 TTTAGATGAGCAGTGCACAGTGG - Intergenic
1194010332 X:88553802-88553824 TTTGGCTGGGGAGTGAACAAAGG - Intergenic
1194563088 X:95447213-95447235 CTCCACTGGGCAGTGCCCAGAGG + Intergenic
1194691017 X:96984737-96984759 TCTGGTTGGCCATTGCCCAGCGG - Intronic
1195942362 X:110176694-110176716 TGGGGCAGGGCAGTGCCCTGGGG + Exonic
1199208108 X:145173428-145173450 TTTGCCTGGGCAGGGGACAGTGG - Intergenic
1202624844 Y:56846771-56846793 TTTGTCTGGGCTCTGCCCACAGG + Intergenic