ID: 1152089283

View in Genome Browser
Species Human (GRCh38)
Location 17:78237996-78238018
Sequence TTTGGCTGGGCAGTGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152089277_1152089283 9 Left 1152089277 17:78237964-78237986 CCCTGAATGTCAGCTTGGGTCAG 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089278_1152089283 8 Left 1152089278 17:78237965-78237987 CCTGAATGTCAGCTTGGGTCAGT 0: 1
1: 0
2: 1
3: 15
4: 118
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089273_1152089283 19 Left 1152089273 17:78237954-78237976 CCAGACCTGGCCCTGAATGTCAG 0: 1
1: 0
2: 1
3: 18
4: 284
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089274_1152089283 14 Left 1152089274 17:78237959-78237981 CCTGGCCCTGAATGTCAGCTTGG 0: 1
1: 0
2: 3
3: 19
4: 204
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252
1152089272_1152089283 29 Left 1152089272 17:78237944-78237966 CCAGTGAGATCCAGACCTGGCCC 0: 1
1: 1
2: 1
3: 20
4: 186
Right 1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152089283 Original CRISPR TTTGGCTGGGCAGTGCCCAG AGG Intronic