ID: 1152089428

View in Genome Browser
Species Human (GRCh38)
Location 17:78238616-78238638
Sequence GCATGTGCATGTGTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1108
Summary {0: 2, 1: 2, 2: 27, 3: 171, 4: 906}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152089428 Original CRISPR GCATGTGCATGTGTGTGCTG GGG Intronic
900089079 1:911528-911550 GCATGTGCTTGCGGGGGCTGGGG + Intergenic
900122098 1:1053073-1053095 ACACATGCATGTGTGTACTGGGG + Intronic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900215602 1:1479961-1479983 GCCTGTGTGTGTGTGTGGTGGGG - Intronic
900277684 1:1842627-1842649 GCATGCACATGTGTGTGCAGTGG + Intronic
900285130 1:1895432-1895454 GCCTCAGCAGGTGTGTGCTGAGG - Intergenic
900293911 1:1939210-1939232 GCATATGTGTGTGTGTGCTGGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900968948 1:5978689-5978711 GCAGGCGCATGTGTCTCCTGTGG - Intronic
901001934 1:6153165-6153187 CCATGTCCGTGTGTGTGGTGTGG - Intronic
901474173 1:9478022-9478044 GCAGGTGCATGTATGTAGTGTGG - Intergenic
901656747 1:10773771-10773793 GGATGTGTGTGTGTGAGCTGGGG - Intronic
901742894 1:11353887-11353909 GCATGTGGCTGTGTGTCCAGTGG - Intergenic
901815429 1:11790912-11790934 GCATGTGTGCGTGTGTGCGGGGG - Intronic
901853079 1:12028454-12028476 GCATGTGCATGGTTCAGCTGAGG - Intronic
902392477 1:16114677-16114699 GCATGTGCATGTATGTAGTGGGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903668089 1:25020242-25020264 GCATGTGCATGTGTATGTGCAGG - Intergenic
903693917 1:25193620-25193642 GCATGAACGTGTGTGTTCTGTGG - Intergenic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
904479048 1:30782820-30782842 GCAGGAGCAGGTGTGTGCAGGGG - Intergenic
904598761 1:31662492-31662514 GCACCTGTGTGTGTGTGCTGAGG - Intronic
904605025 1:31693307-31693329 CCATATGCTTGTGTGTGGTGGGG - Intronic
904637910 1:31898721-31898743 TCATGTGCAAGTGTGATCTGTGG + Intergenic
904852304 1:33468244-33468266 CTATGTGCATGTATGTTCTGGGG - Intergenic
905124814 1:35708777-35708799 GCATGTGTATGTGTGTGAACGGG + Intergenic
905177039 1:36143235-36143257 GCATTTACGTGTGTGTGTTGGGG + Intronic
905446794 1:38032864-38032886 GCCTCTGCATGTGTGTGCATGGG + Intergenic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905676408 1:39828461-39828483 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
905974822 1:42166957-42166979 TGAGGTGCGTGTGTGTGCTGAGG + Intergenic
905974832 1:42167276-42167298 TGAGGTGCGTGTGTGTGCTGAGG + Intergenic
906591514 1:47029207-47029229 GCACCTGCATGTGTGTGTTTTGG - Intronic
906606841 1:47178864-47178886 GCAGGAGCATGTGTGGGATGAGG - Intergenic
906733143 1:48100447-48100469 GTGTGTGCATGTGTGTAGTGGGG + Intergenic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
907325216 1:53633525-53633547 GCGTGTGAATGTGTGTGACGGGG + Intronic
909173810 1:72328385-72328407 ACATGTGCATGTTTGTTATGTGG - Intergenic
909458113 1:75873438-75873460 ACATGTGCATGTTTGTTATGTGG + Intronic
909608305 1:77528707-77528729 GCATGTAGATGTGTGTAATGAGG + Intronic
909895385 1:81062788-81062810 ATATGTGTATGTGTGTGCAGTGG - Intergenic
911817375 1:102369928-102369950 TCATGTGCATATGTGTGTGGAGG + Intergenic
912451024 1:109767905-109767927 GCATGTGTATGTGTATGTGGCGG + Intronic
912494230 1:110081114-110081136 ACATGTGTTTGTGTGTGTTGGGG + Intergenic
912581169 1:110722277-110722299 GCATGTGCATATGTATGTTTAGG + Intergenic
912608639 1:111019440-111019462 GCATTTGCAGTTGTGTACTGTGG - Intergenic
913260578 1:116994349-116994371 GAATGTGCATGTATATGTTGAGG + Intergenic
913511810 1:119569128-119569150 GCTTGTGCATGTGCCTGCTAGGG + Intergenic
914240989 1:145852976-145852998 GTATGTGCATGTGTGTGGAGGGG - Intronic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
914941493 1:152027128-152027150 GAGTGTGCATGTGTTTCCTGTGG + Intergenic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915391385 1:155547300-155547322 ACATGTGCATGTGTCTTCAGAGG - Intronic
915525702 1:156475070-156475092 ACATGTGCATGTGTGCACTTGGG - Intronic
915589774 1:156864147-156864169 ACATGTGCATGTGTGACTTGAGG + Intronic
915589779 1:156864260-156864282 GCATGTGCATGTGTATTGTGAGG + Intronic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
915612085 1:157002027-157002049 GCATGTGCATGTATGGGATTGGG + Intronic
916619329 1:166478774-166478796 GGATATGCATGTGTGTGGCGGGG + Intergenic
916743943 1:167669978-167670000 GCGTGTGCGTGTGTGTCCTGAGG - Intronic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917081564 1:171261306-171261328 GTGTGTGCCTGTGTGTGTTGGGG - Intronic
917232957 1:172857608-172857630 GTATGTGTATCTGTGTGTTGGGG - Intergenic
917693152 1:177489819-177489841 GCACGTTCATATGTGTGGTGGGG - Intergenic
917902701 1:179558955-179558977 GAATGTGTATGTGTGTGTTTAGG + Intronic
918104247 1:181402719-181402741 ATATGTACATGTGTGTGCAGGGG - Intergenic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919421682 1:197377117-197377139 GCATGTGTTTGTATGTGTTGGGG - Intronic
919423465 1:197400973-197400995 GTATATGTATGTGTGTGTTGGGG - Intronic
919546930 1:198935482-198935504 GCATGTGCATCTGTATGATGTGG + Intergenic
919981533 1:202645062-202645084 GTGTGTTCATGTGTGGGCTGGGG + Intronic
920191231 1:204195127-204195149 GGGTGTGTGTGTGTGTGCTGGGG - Intronic
920224980 1:204431865-204431887 GGAAGTGTATGTATGTGCTGAGG + Intronic
920353112 1:205350857-205350879 GCATGTGTGTGTGTGTGCTGAGG + Intronic
920657286 1:207886396-207886418 GCTGGTGCCTGTGTCTGCTGAGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920691473 1:208150191-208150213 GCATGTGCGTGTGTGTGTAAGGG - Intronic
920868303 1:209771655-209771677 GCATGTGAAGGTGTGTGTTCAGG + Intronic
921069784 1:211649436-211649458 GGGTGTGCATGTGTGTCCTTGGG + Intergenic
921254536 1:213327597-213327619 GCATGTGTATGTGTGTGTTTTGG + Intergenic
921334011 1:214068068-214068090 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
923024399 1:230193453-230193475 GCGTGAGCCTCTGTGTGCTGGGG + Intronic
923024403 1:230193479-230193501 GCATGCGCCTCTCTGTGCTGGGG + Intronic
923024407 1:230193505-230193527 GCGTGCGCCTCTGTGTGCTGGGG + Intronic
923280137 1:232435964-232435986 GAATGTGCGTGTGTGTGCCTGGG + Intronic
923301935 1:232649394-232649416 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923678712 1:236102049-236102071 GGCTGTGCATGTGTGTTATGTGG + Intergenic
924458369 1:244236486-244236508 GACTGTGCATGTGAGTGCAGAGG - Intergenic
924861221 1:247924683-247924705 GCATGTGTATATGTGTGGGGTGG - Intergenic
924933961 1:248752471-248752493 TGATGTGCATGTGTGTGGTGAGG - Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1062794908 10:337473-337495 TGATGTGTATGTGTGTGCTGTGG + Intronic
1062794955 10:337919-337941 TGATGTGTATGTGTGTGCTGTGG + Intronic
1062825651 10:566614-566636 GCCTGGGCTTCTGTGTGCTGGGG - Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1062953685 10:1526035-1526057 GCATGTGCATCTGTGTTGAGGGG + Intronic
1062981151 10:1724195-1724217 GCATGTGCCTGTGTGTCCTCAGG + Intronic
1063342811 10:5284031-5284053 GGATGTGCATGTGCGTGTTTGGG + Intergenic
1063342813 10:5284037-5284059 GCATGTGCGTGTTTGGGGTGAGG + Intergenic
1064053091 10:12074993-12075015 GCATGTGCCTGTGGAGGCTGAGG + Intronic
1064087378 10:12355486-12355508 GCGTGTGTATGTGTGTGTGGTGG + Intronic
1064608089 10:17065137-17065159 GTCTGTGCATGTGTGTGTGGGGG - Intronic
1064879608 10:20036116-20036138 GGACCTGTATGTGTGTGCTGTGG + Intronic
1065166829 10:22988058-22988080 GGATGTGCATTTGAGTGCTTTGG + Intronic
1065752601 10:28900978-28901000 GAATGTGTGTGTGTGTGCTGGGG + Intergenic
1065828711 10:29595422-29595444 GCACGTGCCTTTCTGTGCTGTGG - Intronic
1066054823 10:31671030-31671052 TCATGTGCATCTTTGTGATGAGG - Intergenic
1066055103 10:31673599-31673621 TCATGTGCATCTTTGTGATGAGG - Intergenic
1066184235 10:32993610-32993632 GGATGTGTATGTGTGTGTAGTGG + Intronic
1066478447 10:35771321-35771343 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067211045 10:44260720-44260742 GCCTGTGCAGCTGGGTGCTGAGG + Intergenic
1067581511 10:47449527-47449549 ACCTCTGCCTGTGTGTGCTGGGG + Intergenic
1067854045 10:49776286-49776308 ACATGTGCATGTTTGTTATGTGG - Intergenic
1068243322 10:54334314-54334336 GAATGTGAATGTGTGTGGCGTGG - Intronic
1068276007 10:54797786-54797808 ACATGTGTATGTGTGGGCAGGGG + Intronic
1068375995 10:56181966-56181988 GCATGTGCATGTTTGTTATATGG - Intergenic
1068788259 10:61001082-61001104 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1069108688 10:64415807-64415829 GGATATGCATGTGTGTTGTGGGG + Intergenic
1069289709 10:66763043-66763065 GTATGTGCATGTCTGTGGGGTGG + Intronic
1069953318 10:72034478-72034500 ACACGTGCATGTGTGTGTGGAGG - Intergenic
1070676174 10:78413146-78413168 GCGTGCACATGTGTGTGTTGGGG + Intergenic
1070975154 10:80600537-80600559 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1071257324 10:83882637-83882659 GCACGTGTGTGTGTGTTCTGTGG - Intergenic
1071519000 10:86317355-86317377 GCATGTGAGTGGGTGTTCTGTGG + Intronic
1071849541 10:89554646-89554668 ACATATGTATGTGTGTGTTGTGG + Intronic
1071986124 10:91052460-91052482 GCATATGCAGGTGTGTACAGAGG + Intergenic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072422554 10:95301373-95301395 GTATGTGAGTGTGTGTGTTGAGG + Intergenic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1072798728 10:98376837-98376859 GTGTGTGTTTGTGTGTGCTGTGG + Intergenic
1072993368 10:100220194-100220216 GGATGTGCATGTATGTGTTTTGG + Intronic
1073007238 10:100333990-100334012 GCAGGTGCATGTGTGTGGGATGG + Intergenic
1073201077 10:101736361-101736383 GGGTGTGGTTGTGTGTGCTGTGG + Intergenic
1073337139 10:102718285-102718307 CTGTGTGTATGTGTGTGCTGAGG + Intronic
1074180849 10:111061488-111061510 GCCTGTGGGTGTGTCTGCTGAGG + Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1074869078 10:117562906-117562928 GCATGTGTATGAGTGTGCATAGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075275345 10:121088000-121088022 ACATGTGTATGTATGTGCAGGGG - Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654895 10:124154755-124154777 GAATGTGCATGTGAGTGTGGGGG - Intergenic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1076054726 10:127362990-127363012 GGATGTGCGTGTGTGTGTGGGGG - Intronic
1076357645 10:129864720-129864742 GTAGGTGCCTGTGTCTGCTGCGG - Intronic
1076389306 10:130086200-130086222 GCATGGACCTGTGTGTGATGTGG - Intergenic
1076422027 10:130338589-130338611 GTATGTGCGTGTGTGTGTGGGGG + Intergenic
1076612091 10:131732560-131732582 GCATGTGTGTGTGTGTGCCTGGG - Intergenic
1076622582 10:131801735-131801757 GCTTGTGGATGTGTGGTCTGTGG - Intergenic
1076778870 10:132713144-132713166 GCATGTGTATGTGTGTGTGCGGG + Intronic
1076799307 10:132813306-132813328 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799316 10:132813337-132813359 GCAGGGGCAGGTGTGTGCAGAGG - Intronic
1076799318 10:132813353-132813375 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799349 10:132813476-132813498 GCAGGGGCAGGTGTGTGCAGAGG - Intronic
1076799364 10:132813538-132813560 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799374 10:132813568-132813590 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799384 10:132813598-132813620 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799394 10:132813628-132813650 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799404 10:132813658-132813680 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799414 10:132813688-132813710 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076866016 10:133166739-133166761 GCATGTGCATGGGGGGGGTGTGG + Intronic
1076903073 10:133349474-133349496 GTCTGTGCATGTGTGTTTTGTGG - Intronic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1079629580 11:22657542-22657564 GCATGTGAGTGTGTGTGAGGGGG - Intronic
1080855848 11:36111019-36111041 GCATGTGTATGTGTGGGGAGTGG + Intronic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1081004022 11:37711184-37711206 TCATGTTCGTGTGTGTGCTCTGG - Intergenic
1081087750 11:38822436-38822458 GTATGTGCATGTGTGTGGTCAGG - Intergenic
1081292571 11:41344652-41344674 TCTTGTCCATGTGTGTGCTATGG - Intronic
1081408168 11:42722376-42722398 GCATGTGTGTGTGTGTGTGGTGG - Intergenic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1081994810 11:47356690-47356712 GCAGGGGCATGTGTGTGCAAGGG - Intronic
1083257176 11:61503805-61503827 GCATGTGTATGTGTGTGTGTTGG - Intergenic
1084454091 11:69257413-69257435 TCATATGCAGCTGTGTGCTGGGG - Intergenic
1084949235 11:72655523-72655545 GCATGTGTGTGTGTGTGCACAGG + Intronic
1085527197 11:77171211-77171233 GCGTGTGTATGTGCATGCTGAGG + Intronic
1085761026 11:79241726-79241748 GTGTGTGCATGTGTATGGTGGGG + Intronic
1086853692 11:91841121-91841143 GCATCTGCACATGTGCGCTGGGG - Intergenic
1086905404 11:92412849-92412871 GGCTGTGCATGTGTGTGTAGGGG - Intronic
1087161471 11:94951849-94951871 GTATGTGCATGTATGTGCAGGGG + Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088071710 11:105794411-105794433 ATATGTGTATGTGTGTGCCGGGG + Intronic
1088133704 11:106527734-106527756 ACATGGGCATGTCTGTGCTTTGG + Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088865009 11:113839246-113839268 GCCTGTGCCTGTGTATGCTATGG - Intronic
1088902306 11:114127488-114127510 GCATGTGTGTGTGTGTACTGGGG - Intronic
1089807939 11:121108274-121108296 GTGTGTGTATGTGTGTACTGGGG - Intronic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090399174 11:126437460-126437482 GCATATGCATGTTTGTAGTGTGG - Intronic
1091107633 11:132937620-132937642 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1091116710 11:133019923-133019945 GCATGTGCATGTGTGCACTGGGG - Intronic
1091215943 11:133901963-133901985 TGGTGTGCATGTGTGTGATGCGG - Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091811193 12:3399242-3399264 TCATCTGCATCTGTGTCCTGTGG - Intronic
1092119299 12:6032751-6032773 GCATGTGCCTGTGTGTATTTGGG - Intronic
1092496065 12:8996159-8996181 GCATGTGTGTGTGTGTGTGGTGG + Intronic
1092632830 12:10402290-10402312 GCAAGTGCATGTGTCTTTTGGGG - Intronic
1092791391 12:12073551-12073573 GCATGTGTGTGTGTGTGGCGGGG - Intronic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1092940507 12:13403193-13403215 GCATGTGCATATGTGTGTGGGGG + Intergenic
1093055932 12:14555622-14555644 GAATGTGCGTGTGGGTGATGAGG - Intronic
1093253110 12:16832706-16832728 GCACATGCATGTGTGTGTTGGGG + Intergenic
1093492529 12:19721424-19721446 GCATGTGCATGTTTTTGATTTGG + Intergenic
1093852635 12:24059582-24059604 GCAGGTGTGTGTGTGTGATGGGG + Intergenic
1094482494 12:30895984-30896006 TCATCTGCATCTGTGTCCTGTGG + Intergenic
1094527022 12:31238103-31238125 GCAGGTGCATGTGGCTGCAGGGG + Intergenic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1095246613 12:39930452-39930474 GAATGTGAATGTGTGTATTGTGG + Intronic
1095293201 12:40499805-40499827 GCATGTGTATGTGTGTGCATGGG + Intronic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1095827742 12:46547836-46547858 GCATGTGCTTGTGTGTGAGGAGG + Intergenic
1096179286 12:49541765-49541787 GTAGGTGCATGTAGGTGCTGTGG + Intronic
1096232315 12:49903434-49903456 GCATGGGTATGTGTGTGCCAGGG - Intronic
1096341033 12:50799381-50799403 GCATGTGCATGTGTGTATTTGGG - Intronic
1096476283 12:51911122-51911144 GCATGTGCAGGTGTGTGTCTGGG - Intronic
1096531228 12:52244062-52244084 GCCTGTGCAGGTGTCTGCAGTGG + Intronic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097177486 12:57151809-57151831 GTATGTGCGTGTGTGTGTGGTGG + Intronic
1097190864 12:57218907-57218929 TCTGGTGCATCTGTGTGCTGGGG + Intronic
1097287396 12:57888756-57888778 GGAAGTGCATGTGTGTGGTGCGG + Intergenic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1098195820 12:68001072-68001094 GTGTGTGTATGTGTGTGCTCTGG - Intergenic
1098568957 12:71967951-71967973 GGATGTGCATGTGTTTTTTGGGG + Intronic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099378933 12:81932116-81932138 GCATGTGTGTGTGTGTGGAGGGG - Intergenic
1099888965 12:88566203-88566225 GCAGTTTCATGTGTCTGCTGAGG + Intronic
1100712049 12:97268218-97268240 GAATCTGAATGTGTATGCTGAGG + Intergenic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1101945272 12:109131542-109131564 GCATGGGGATGAGTGTGCTGTGG + Intronic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1102237871 12:111305916-111305938 GCATGTGTTAGTGTGTGCTGTGG + Intronic
1102825795 12:115946998-115947020 GCACGTGTATGTGTGTGAGGAGG - Intergenic
1103134667 12:118497414-118497436 GCATGTTCTTGTGGGTGCAGTGG - Intergenic
1103730596 12:123025229-123025251 GCATGTGCATCTGTGTGCCTAGG - Intronic
1103907205 12:124333804-124333826 GCATGTGCCTGTGTCTACAGGGG + Intronic
1104063543 12:125287721-125287743 GCATGTGCATTTGTTTGTTCTGG - Intronic
1104141107 12:125986226-125986248 GCAGGTGCAGGTTTGTGGTGGGG + Intergenic
1104557827 12:129817866-129817888 GTATGTGTGTGTGTGTGGTGTGG + Intronic
1104667280 12:130656426-130656448 GCCAGTGCATTTGTGTCCTGAGG + Intronic
1104931765 12:132343294-132343316 GCATGTGTATGTGAGTGCTATGG + Intergenic
1105015567 12:132784769-132784791 ACATGTGCATGTGTGGTGTGGGG - Intronic
1105558269 13:21466138-21466160 ACCTGTGCAAATGTGTGCTGAGG - Intergenic
1105692653 13:22857639-22857661 GCATGTGTGTGTGTGTGTAGTGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106138741 13:26993379-26993401 GCAGGTGCAGGTGTGTGATTGGG + Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106468306 13:30032517-30032539 GCATGTGTTTGTGTGTGCATGGG + Intergenic
1106752032 13:32783212-32783234 GCATCTGTGTGTGTGTGTTGAGG - Intergenic
1106935540 13:34714641-34714663 GCATCTCTATGTGTATGCTGTGG - Intergenic
1107216628 13:37928362-37928384 ACATGTGGATGCGTGTACTGGGG + Intergenic
1107451950 13:40517718-40517740 GTATCTGCATGTGTCTCCTGGGG - Intergenic
1107456844 13:40563165-40563187 GCATGAGGATGTGGGCGCTGTGG - Intronic
1107658792 13:42617953-42617975 GCATGTGCATGTGTGTTTAATGG + Intergenic
1107820620 13:44282446-44282468 CCATGTGTATGTGTGTGTTTTGG - Intergenic
1109192665 13:59344290-59344312 GTGTGTGCATGTGTATGCTTTGG - Intergenic
1109928728 13:69184039-69184061 GCATGTGTGTGTGTGTGGAGAGG - Intergenic
1110441218 13:75527996-75528018 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1110813284 13:79834375-79834397 GCTGGTGCATGTGTGAGTTGGGG + Intergenic
1110929485 13:81196756-81196778 GTACGTGCATGTGTATGCTTGGG + Intergenic
1110967006 13:81712994-81713016 GCATTTGCAGCTGTGTTCTGTGG + Intergenic
1111219990 13:85192063-85192085 GGTTGTGCATGTCTGTGCTTGGG + Intergenic
1111656964 13:91166002-91166024 GACTGTGCGTGTGTGTGTTGGGG + Intergenic
1112206977 13:97334115-97334137 GCATGCTCATGTGTTTGTTGGGG - Intronic
1112439389 13:99415172-99415194 GCATGTGCATGGGTGTGAGTGGG - Intergenic
1112688526 13:101861713-101861735 GCGTGTGTGTATGTGTGCTGTGG - Intronic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1113053565 13:106241477-106241499 GGATGTGCATATGTGTAGTGGGG - Intergenic
1113165080 13:107431374-107431396 GCATGTGTGTGTGTGTGTTTAGG - Intronic
1113257748 13:108525461-108525483 GAATGTGCATTTATTTGCTGTGG + Intergenic
1113413276 13:110108742-110108764 GCATGAGGTTGTGTGGGCTGTGG + Intergenic
1113493025 13:110706762-110706784 GGATGCTGATGTGTGTGCTGGGG - Intronic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113671762 13:112180403-112180425 GCATATGCATGAGTCTACTGAGG + Intergenic
1113697695 13:112358310-112358332 GAATGTGCATGTGTGTTGTGGGG + Intergenic
1113901366 13:113800154-113800176 GTATGTGTATGTGTGTGTGGAGG + Intronic
1113957079 13:114104816-114104838 GGGTGAGCATGTGTGGGCTGGGG - Intronic
1114065906 14:19059765-19059787 CCAGGAGCGTGTGTGTGCTGTGG - Intergenic
1114185701 14:20400296-20400318 GCGTGTGTGTGTGTGTGCAGTGG + Intronic
1114742283 14:25109690-25109712 GCATCTGTATTTGTGTACTGTGG + Intergenic
1115026466 14:28752674-28752696 GCATGTGTGTGTGTGTGCATGGG + Intergenic
1115888724 14:38003711-38003733 GTATGTGTGTGTGTGTGGTGGGG + Intronic
1116410057 14:44610383-44610405 GCATGTTTGTGTGTGTGTTGGGG + Intergenic
1117164844 14:53022984-53023006 GCATGAGCTTGTGTGTGGTGTGG + Intergenic
1117486013 14:56197861-56197883 GCATGTGTGTGTGTGTGCACAGG - Intronic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118570877 14:67194437-67194459 GCGTGTGTGTGTGTGTGCTGTGG + Intronic
1118988865 14:70780103-70780125 TAATGTGCATATGTGTTCTGGGG + Intronic
1119105503 14:71919593-71919615 GCCTGCACATGTGTGTGCTGGGG + Intergenic
1119144812 14:72302661-72302683 GTATGTGTATGTGTGTGTTGGGG - Intronic
1119262781 14:73247518-73247540 GTATGTGTGTGTGTGTGTTGTGG + Intronic
1119519286 14:75273924-75273946 GCATGTGTGTGTGTGTGGGGGGG + Intergenic
1119524770 14:75313969-75313991 GCATGTGTATGTGTGTAACGTGG + Intergenic
1119804721 14:77475329-77475351 ATATGTGCATGTGTCTGCCGGGG - Exonic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1120690897 14:87591134-87591156 GCGTGTGTGTGTGTGTGGTGGGG - Intergenic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1121115206 14:91338455-91338477 GCCTGAGCCTGTGTGTCCTGGGG - Intronic
1121566562 14:94914503-94914525 GGATGGGCAGGTGTGTGGTGTGG - Intergenic
1122119398 14:99543903-99543925 GCATGCCCATTTGTGGGCTGTGG - Intronic
1122455239 14:101845225-101845247 GAATGTGCATGTGTGTCCACAGG + Intronic
1122799740 14:104223554-104223576 GCATGAGCAGCTGAGTGCTGGGG + Intergenic
1123064023 14:105607084-105607106 GGGAGTGCGTGTGTGTGCTGGGG + Intergenic
1123073337 14:105652727-105652749 GGGAGTGCGTGTGTGTGCTGGGG + Intergenic
1123190273 14:106562679-106562701 GCATGTCCAGCTGTGTCCTGGGG - Intergenic
1123201537 14:106670262-106670284 GCATGTCCAGCTGTGTCCTGGGG - Intergenic
1123984325 15:25631606-25631628 GCATGTGCAGGTATGTGCGTGGG + Intergenic
1124200184 15:27672731-27672753 GCATGTGCATGTGTGTGTATGGG - Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124497221 15:30193798-30193820 GTGTGTTCATGTGTGGGCTGGGG + Intergenic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1124678753 15:31711008-31711030 GCATGTGCAGGTGTGTATTTCGG + Intronic
1124746353 15:32344849-32344871 GTGTGTTCATGTGTGGGCTGGGG - Intergenic
1124884692 15:33674227-33674249 GCATGTGCGTATTTGTGTTGAGG - Intronic
1125186221 15:36933586-36933608 GTATGTGTGTGTGTGTGGTGGGG + Intronic
1125463164 15:39925291-39925313 GCATGTGAGGGTGTGTGATGGGG - Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1125735876 15:41925488-41925510 GCATGTACTAGTGTGTGTTGTGG + Intronic
1126066833 15:44832251-44832273 GTATGTGCATGTGTGAGGAGAGG - Intergenic
1126093000 15:45068300-45068322 GTATGTGCATGTGTGAGGAGAGG + Intronic
1126270584 15:46812613-46812635 GCATGTGTGTGTGTGTGAGGGGG - Intergenic
1126685560 15:51246262-51246284 GCATGTACATGTGTGTTTGGGGG - Intronic
1126969092 15:54089527-54089549 GTATGTGCATGTGTGTTCACTGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127529547 15:59830145-59830167 GGCTGTGTATGTGTGTGCGGTGG - Intergenic
1127629102 15:60809619-60809641 AAATGTGCATGTGTGTGGTGGGG - Intronic
1127650226 15:60999651-60999673 ACATCTGTCTGTGTGTGCTGGGG + Intronic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128412212 15:67411022-67411044 GCATGTGCAGGGGTGGGGTGGGG - Intronic
1128563607 15:68684522-68684544 GCATATACATGTGTATGTTGCGG + Intronic
1128847240 15:70910133-70910155 GTATGTGCGTGTGTGTGATAAGG + Intronic
1128999545 15:72320472-72320494 GTGTGTGCCTGTGTGTGCGGTGG - Exonic
1129309627 15:74696924-74696946 GTATGTGCCTGTGTGTACAGGGG - Intergenic
1130303555 15:82698485-82698507 GCATGTGTGTGTGTGTGTAGGGG - Intronic
1130381423 15:83375481-83375503 CTATGTGTATGTGTGTGCAGTGG - Intergenic
1130450804 15:84049951-84049973 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
1130836663 15:87656475-87656497 GCATGGGCATGTGTGTGTGGAGG + Intergenic
1131107877 15:89747029-89747051 GCATGCGCATGTGTGTGTGGTGG - Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131855465 15:96588780-96588802 GCACATGCATGTGTGTGGGGGGG + Intergenic
1131876298 15:96810094-96810116 CAATGTCCCTGTGTGTGCTGAGG + Intergenic
1132360404 15:101208169-101208191 GCATGTGTGTGTGTGTCCTTGGG - Intronic
1133222196 16:4323562-4323584 GAGTGTGCGTGTGTGTGCCGGGG + Intronic
1133542924 16:6773601-6773623 GTATGTGCATGTGTGGGCATGGG + Intronic
1133989543 16:10694016-10694038 GCCTGAGCATGTGTGTGTTCTGG - Intronic
1134015510 16:10885321-10885343 GCATGTGTATGTGTGTAATGGGG - Intronic
1134518819 16:14908494-14908516 GTGTGTGTGTGTGTGTGCTGAGG + Intronic
1134706490 16:16307149-16307171 GTGTGTGTGTGTGTGTGCTGAGG + Intergenic
1134807648 16:17139408-17139430 ATATGTGCTTGTGTGTGCTGGGG + Intronic
1134961050 16:18404975-18404997 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1134965352 16:18487578-18487600 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1135016457 16:18928037-18928059 GGATATGCATGTGTGTGAAGGGG - Intergenic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135111410 16:19693267-19693289 GTATGTGGATGTGTGTGTTGCGG + Intronic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135529743 16:23242790-23242812 GCATACGCATGTGTGTGGTGAGG + Intergenic
1135675708 16:24413221-24413243 GCATGTGTATGTCTGTGCCCTGG - Intergenic
1135739193 16:24958756-24958778 GCATGTGTCTGTGTGTGTTGTGG - Intronic
1135991264 16:27220258-27220280 CCATAAGCATGTGTGTGGTGGGG + Intronic
1136107366 16:28039703-28039725 GGATGTGCATGTGTGTGCACAGG - Intronic
1136377516 16:29874048-29874070 GGAAGTGCGTGTGTGTGCAGAGG - Intronic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136876572 16:33863050-33863072 GCATGTGTGTGTGTGTGGGGGGG - Intergenic
1137254355 16:46762879-46762901 GCAAGTGCATGGGTTTGCTTTGG - Intronic
1137365224 16:47854083-47854105 GTGTGTGCGTTTGTGTGCTGGGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137512878 16:49116821-49116843 TAATGTGTATGTGTGTGGTGCGG - Intergenic
1137868896 16:51930399-51930421 GCGTGTGTGTGTGTGTGATGAGG - Intergenic
1138059394 16:53874212-53874234 GCTTGTGCATGTGTTAGCTGTGG + Intronic
1138221360 16:55254312-55254334 ACATGTGCATGTTTGTTATGTGG + Intergenic
1138584893 16:57963167-57963189 TCATCTGTATGTGTGTGGTGTGG + Intronic
1138832416 16:60390683-60390705 GCATGTACATGTGTTTCCTGAGG - Intergenic
1138936101 16:61725900-61725922 GCGTGTGTGTGTGTGTGGTGTGG + Intronic
1139199777 16:64962573-64962595 GTATGTGCATGTGTGTGGTAGGG - Intronic
1139241306 16:65394971-65394993 GCACGTGTGTGTGTGTCCTGGGG + Intergenic
1139819389 16:69708617-69708639 TCACGTGCATGTGTGAGATGTGG - Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140477916 16:75248261-75248283 GCGGGTGCATGTGTGCGTTGGGG - Intronic
1140627330 16:76810073-76810095 GGATGTGCATGTGTGATCTGAGG - Intergenic
1141280072 16:82623416-82623438 ACATGGGTGTGTGTGTGCTGGGG - Intergenic
1141307605 16:82881180-82881202 GCATGTGCTTGGGTGTGTAGAGG + Intronic
1141368999 16:83470110-83470132 ACAGGTGTATGTGTGTGCAGGGG - Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141805590 16:86339317-86339339 GCATGTGCAGGTTTGTTATGTGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142423858 16:89990345-89990367 TCATATGCATGTATTTGCTGGGG + Intergenic
1142483584 17:233143-233165 ACGTGTGCGTGTGTGTGCAGAGG + Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1142753026 17:1999677-1999699 GCCTGTGCGTGTGTGTGTGGGGG - Intronic
1142976195 17:3646048-3646070 GCAGGTGCATGACTGTGATGAGG - Intronic
1143378847 17:6483320-6483342 GCCTGGGCCTGGGTGTGCTGGGG - Intronic
1143390896 17:6558629-6558651 GTGTGTGCTTGTGTGTGCTTAGG + Intergenic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1143529774 17:7496064-7496086 ACATGTGCAGGTAAGTGCTGGGG + Exonic
1143835267 17:9686951-9686973 GCATGTGCATGCGTGTGTGTGGG + Intronic
1143862040 17:9898016-9898038 GCATGTGTGTGTGTGTGCACAGG + Exonic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1144586946 17:16492548-16492570 GCATGGGGGTGTGTGTGTTGGGG + Intergenic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1144792684 17:17869937-17869959 GCATATGCATGTGTGTGTACAGG - Intronic
1144976428 17:19141555-19141577 GTGTGCGCTTGTGTGTGCTGGGG + Intronic
1146157923 17:30539546-30539568 GAATGTGTGTGTGTGTGGTGGGG - Intergenic
1146241759 17:31235789-31235811 TTGTGTGTATGTGTGTGCTGAGG + Intronic
1146593400 17:34148576-34148598 GGATCTACATCTGTGTGCTGAGG + Intronic
1146624196 17:34423642-34423664 ACGTGTGCATGTGTCTGTTGTGG + Intergenic
1146692149 17:34883881-34883903 GCATGTGTCTGTGTGTGCCGGGG - Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1146913303 17:36661741-36661763 GCAGGTGCATGTGTGTGTCTGGG - Intergenic
1146913322 17:36662017-36662039 GCATGTGCATGTGTGTGTCTGGG - Intergenic
1146925476 17:36741964-36741986 GTATGTGAGAGTGTGTGCTGTGG + Intergenic
1146968332 17:37052100-37052122 CCATGAGTGTGTGTGTGCTGGGG + Intronic
1147139470 17:38453297-38453319 GCAGGTGGATGTGTGTGGTGCGG + Intronic
1147176715 17:38660400-38660422 GGATATGCATGTGTGTGCACCGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147383423 17:40068927-40068949 TTTTGTGCATGTGTGGGCTGGGG + Intronic
1147669379 17:42167945-42167967 GAATGGGCATGTGAGTGCTGCGG - Intronic
1147747670 17:42705244-42705266 GGATGTGCACATGTGTGGTGGGG + Intronic
1147985946 17:44308093-44308115 GCATCTGCATGTCTGTGCCTGGG - Intergenic
1148228352 17:45915262-45915284 GAGTGTGTATGTGTGTGGTGTGG + Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148679451 17:49465419-49465441 GCGTGCGCGTGTGTGTACTGAGG + Intronic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1148855616 17:50577751-50577773 GCAGGTGCACGTGTCTGGTGTGG + Intronic
1148864074 17:50619542-50619564 ACATGTGCATGTGTGTTGTCTGG + Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149323942 17:55510682-55510704 GCACGTGCGTGTGTGTGATAAGG - Intergenic
1149343892 17:55715234-55715256 GTATGTGCATGTTTCTGCTGAGG - Intergenic
1149571749 17:57677116-57677138 GCACGTGCATGTATGACCTGTGG - Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149712026 17:58752161-58752183 GCAAGTGCATGTGTGTTTGGTGG + Intergenic
1150134961 17:62690481-62690503 ACATGTGCAAGTGTGTGGGGGGG - Intronic
1150429861 17:65106430-65106452 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1151153836 17:72110712-72110734 GCATATGAATATGTGTGCTTTGG + Intergenic
1151334668 17:73432870-73432892 GCATATGTGTGTGTGTGCAGGGG + Intronic
1151364182 17:73606390-73606412 GCAGGTGCTTATGGGTGCTGGGG + Intronic
1151388493 17:73770119-73770141 CCCTGTGCCTGCGTGTGCTGGGG - Intergenic
1151436571 17:74101204-74101226 GCCTGTGCGTGTGTGTGTTCTGG - Intergenic
1152000258 17:77640889-77640911 CCATGTGCGTGTGTGGGCGGTGG + Intergenic
1152009034 17:77699532-77699554 GCATGTGCATGTGTTGGGTGAGG + Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191884 17:78893111-78893133 ACATGCACATGTGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152296555 17:79470519-79470541 TTAGATGCATGTGTGTGCTGAGG - Intronic
1152318037 17:79592257-79592279 GCATGTGTATGTGGGTGGGGGGG + Intergenic
1152498365 17:80691323-80691345 GCATAGGTATGTGTGTGGTGTGG + Intronic
1152526854 17:80893216-80893238 GCCTGTGCCTGTGTGTGCGCCGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153618101 18:6952437-6952459 TACTGTGCATGTGTGTGCGGGGG + Intronic
1153660776 18:7324288-7324310 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1154133615 18:11757575-11757597 GCATGTGGATATGAGTACTGAGG + Intronic
1154218151 18:12430817-12430839 GGATGTGTATGTGTGTGGTATGG + Intronic
1154324511 18:13380207-13380229 CCTTGTGCATGTGGGTGCTGTGG + Intronic
1155116571 18:22774150-22774172 GCGTGTGCGTGTGTGTGTGGGGG + Intergenic
1155446146 18:25914902-25914924 GTATGTGTATGTGTGTGCTTTGG - Intergenic
1155517028 18:26634409-26634431 ATATATGCATGTGTGTGTTGTGG + Intronic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1156828780 18:41465959-41465981 GCATATGTGTGTGTGTGTTGGGG - Intergenic
1156882283 18:42094993-42095015 GCATGCTTATGTGTGAGCTGTGG + Intergenic
1156977840 18:43246551-43246573 GTATGTGTGTATGTGTGCTGGGG - Intergenic
1157420896 18:47546777-47546799 TCATGTGCTGGGGTGTGCTGGGG + Intergenic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158118804 18:54025966-54025988 GCATGTCCAGTTGTGTCCTGAGG - Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158887938 18:61846528-61846550 GAATGTGCATCTGTGAGTTGGGG - Intronic
1159032981 18:63249950-63249972 GTATGTGCAAGTGTGCGGTGCGG - Intronic
1159087234 18:63807643-63807665 GTATGTGCATGTATGTTGTGTGG + Intergenic
1159375601 18:67588551-67588573 GCATGTGCATGTATGTGTGCAGG + Intergenic
1159695379 18:71551279-71551301 GCATGTGCATATGTGTACATGGG + Intergenic
1159778368 18:72630542-72630564 GCATGTGTGTGTGTGTGGGGGGG - Intronic
1160089109 18:75809248-75809270 GCGTGTGTGTGTGTGTGATGTGG + Intergenic
1160814967 19:1030919-1030941 GCATCTGCGTGGGTGTGGTGAGG + Intronic
1160962424 19:1729306-1729328 GTATGTGCATGTGTGTGTGCAGG + Intergenic
1161094424 19:2381362-2381384 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1161258638 19:3323410-3323432 CCATGTGTGTGTGTGTGGTGGGG - Intergenic
1161280860 19:3444796-3444818 GCGTGTGTGTGTGTGTGCAGGGG - Intronic
1161528514 19:4772549-4772571 GGATCTTCCTGTGTGTGCTGAGG - Intergenic
1161810044 19:6466355-6466377 GTATGTGTGTGTGTGTGTTGTGG + Intronic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162015300 19:7843061-7843083 GTATGTGCATGTGTGTGTATAGG + Intronic
1162015304 19:7843120-7843142 TCATGTGCATGTGTGTGTATAGG + Intronic
1162015308 19:7843177-7843199 GTATGTGCATGTGTGTGTATAGG + Intronic
1162453572 19:10769034-10769056 GCTCCTGCCTGTGTGTGCTGGGG + Intronic
1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG + Intergenic
1162914528 19:13866868-13866890 GTATGTGTGTGTGTGTGGTGGGG - Intronic
1163006158 19:14397833-14397855 GCTTGTCAGTGTGTGTGCTGGGG - Intronic
1163061587 19:14765607-14765629 GCGTGTCAGTGTGTGTGCTGGGG + Intronic
1163223478 19:15938216-15938238 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1163679359 19:18671821-18671843 CCATGTGAATGTGCGTGTTGCGG - Intergenic
1164840958 19:31391684-31391706 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165159243 19:33806142-33806164 CCTGTTGCATGTGTGTGCTGTGG + Intronic
1165182625 19:33985789-33985811 GCATGTGAATGTATGTGAGGAGG + Intergenic
1165312109 19:35034628-35034650 CCATGAGGATGTGTGTGCCGTGG - Intronic
1165984614 19:39757197-39757219 GTGTGTGCCTGTGTGTGTTGGGG + Intergenic
1166046256 19:40232794-40232816 GCACGTCCATGTCAGTGCTGTGG - Exonic
1166157334 19:40923703-40923725 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166166193 19:40990728-40990750 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166222915 19:41377047-41377069 GTACGTGTATGTGTGTGCTGGGG + Intronic
1166887545 19:45971424-45971446 ACATATTCATGTGTGTGCTGGGG + Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167211695 19:48137596-48137618 GCATGAGCCTCTGGGTGCTGCGG + Exonic
1167244577 19:48365485-48365507 GAATGAGGTTGTGTGTGCTGAGG - Intronic
1168018783 19:53594305-53594327 GGCTGTGCAGGTGTGTGTTGTGG + Intergenic
1168191290 19:54740453-54740475 GTATGTCCCTGTGTGTGCGGGGG - Intronic
1168193551 19:54757057-54757079 GTACGTCCCTGTGTGTGCTGGGG - Intronic
925013266 2:502063-502085 GTATCTGCATGTGTGTGATTAGG + Intergenic
925040402 2:728908-728930 GCATGTGCGTGTGTTTTTTGTGG + Intergenic
925154989 2:1642144-1642166 GCATGTGTGTGTGGGTGGTGGGG + Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925571215 2:5314740-5314762 TCGTGTGCATATGTGTGGTGGGG + Intergenic
925572160 2:5324284-5324306 GCATCTGCATGTGTGTGGTTGGG - Intergenic
925711561 2:6746197-6746219 GCATGTGTGTGTGTGTGGTGGGG + Intergenic
926589985 2:14730265-14730287 ACATGTGCATGTGTGTGTGTTGG + Intergenic
926807513 2:16724724-16724746 GTATGTGTATGTGTGTGTTTAGG + Intergenic
927016676 2:18970565-18970587 GTATGTGTGTGTGTGTGTTGGGG - Intergenic
927255918 2:21040889-21040911 GCATGTGTGTGTGTCCGCTGAGG - Intronic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928698537 2:33875258-33875280 GCATATGCATCGTTGTGCTGGGG + Intergenic
928739340 2:34331691-34331713 GCATGTACGTGTGTGTGTGGTGG + Intergenic
929007556 2:37410616-37410638 GCATGTGTGTGTGTGTGCCCAGG - Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929589971 2:43138584-43138606 GTATGTGTGTGTGTGTGGTGCGG - Intergenic
929883768 2:45860609-45860631 ATATGTGCATGTGAGTGCTGGGG + Intronic
931025402 2:58108563-58108585 GCATGTGTCAGTGTGTGTTGAGG - Intronic
931241290 2:60454574-60454596 TCATGTTCATGTGTGTACGGAGG + Intronic
931457807 2:62425880-62425902 ATATGTGCATGTGTGTGGTGAGG - Intergenic
931688530 2:64815520-64815542 TCATGTGCTTGTCTGTGTTGGGG + Intergenic
931920934 2:67014884-67014906 GCATGTGCATGTGTATGTATTGG + Intergenic
932013109 2:67998242-67998264 GGATGTGCGTATGTGTGTTGGGG - Intergenic
932099191 2:68881039-68881061 GTGTGTGCCTGTGTGTGTTGGGG - Intergenic
932111729 2:69008083-69008105 GCGTGAGTATGTGTGTGTTGTGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932224060 2:70025190-70025212 GCATGTGAATGTGTGTGTGTTGG + Intergenic
932759883 2:74432382-74432404 GCATGTGCGTGTGTGGCATGTGG - Intronic
933331228 2:80895524-80895546 GAATATGCATGTGTATGGTGGGG + Intergenic
933408031 2:81887699-81887721 TCATGTTCCTGTGTTTGCTGAGG + Intergenic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934661782 2:96146900-96146922 GCTGGAGCTTGTGTGTGCTGGGG + Intergenic
934856723 2:97734438-97734460 GCAGGTGCTTGTGGGGGCTGAGG + Intronic
934948294 2:98558034-98558056 GAATTTGCATGTGTGTACAGAGG + Intronic
935195146 2:100809345-100809367 CCCTGTGGATGTCTGTGCTGTGG - Intergenic
935255383 2:101305668-101305690 GTATGTGTCTGTGTGTGTTGGGG - Intronic
935572214 2:104673691-104673713 GTATGTGCATGTTTAAGCTGTGG - Intergenic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
936631911 2:114212536-114212558 GCATGTGCATGAGTGTGTGTGGG + Intergenic
937034867 2:118772632-118772654 ACATGTGCCTGTGTGTTTTGAGG + Intergenic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937292782 2:120791615-120791637 GTATGTGCATGTGTTTGCCTGGG + Intronic
937945607 2:127333224-127333246 GCATGTGTGTGTGTGTCATGGGG - Intronic
938119648 2:128624585-128624607 ATATGTGCATGCGTGTGGTGTGG - Intergenic
938159805 2:128975078-128975100 GTATGTGTGTGTGTCTGCTGTGG + Intergenic
938243347 2:129759533-129759555 GCATGTGCTTGTGTGTGGTATGG - Intergenic
938400330 2:130986177-130986199 GCACGTGCATGTGTGTGCATAGG + Intronic
939142082 2:138366587-138366609 CCAAGTGCATGTGTGTGATCAGG + Intergenic
939449698 2:142357714-142357736 GCATGTGTATGTGTGTGTGTAGG - Intergenic
939752749 2:146067767-146067789 GAATGTGTGTGTGTGTGATGGGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942712416 2:178851510-178851532 CCAGGGGCATGTGTGTGCAGAGG + Intronic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
943720055 2:191194529-191194551 GTATGTGTATGTGTGTGCGTAGG + Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
944739925 2:202601889-202601911 GTCTGTGCGTGTGTGTGCTGGGG - Intergenic
945515402 2:210758218-210758240 GCATGTGTTTGTATGTGTTGAGG + Intergenic
945857643 2:215087508-215087530 GCATGTGTGTGTGTGTTTTGTGG + Intronic
945923182 2:215777362-215777384 GCATGGTCATGTGGGTCCTGTGG - Intergenic
946144416 2:217718133-217718155 GCATGTGTGTGTGTGTGTGGTGG - Intronic
946190111 2:218003456-218003478 GCAAATGCATGTGTGTTCCGAGG - Intergenic
946310845 2:218881736-218881758 GCATGTGCGTAAGTGTGCTGGGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948721814 2:239905456-239905478 GCATGCGTATGTGTGTGTGGTGG + Intronic
1168834064 20:865264-865286 AGATGCGCATGTGTGTGCTGAGG - Intergenic
1169247871 20:4038128-4038150 GCATGTGCGTGTGTGTCTGGGGG + Intergenic
1169827688 20:9787965-9787987 CCATGTGTCTGTGTGTGTTGGGG + Intronic
1169932090 20:10844649-10844671 GCATATGTATGTGTGTGAAGGGG - Intergenic
1170008211 20:11692178-11692200 GGTTGTGCATGTGTGTACAGGGG + Intergenic
1171040978 20:21763358-21763380 GCATGTGCAAGAGTGGGCTAGGG + Intergenic
1171133850 20:22678919-22678941 TCATGTGCCTGTGTGTTCTCTGG + Intergenic
1171175012 20:23045205-23045227 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1171179982 20:23085019-23085041 GGATGTGGATGAGTGTGCTCTGG - Exonic
1171960353 20:31489089-31489111 GTATGTGTGTGTGTGTGTTGTGG + Intergenic
1172215087 20:33230040-33230062 GCATGTGTGTGTGTGTGGTGGGG - Intergenic
1173104328 20:40118840-40118862 GAATCTGCATGTGTTTGTTGAGG - Intergenic
1173159730 20:40643486-40643508 ACATATGTATGTGTGTGTTGGGG - Intergenic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173613585 20:44388496-44388518 CCATGTGCTGGTGTGTGATGGGG + Intronic
1173658163 20:44715293-44715315 GCGTGTGCCTGTGTGTGCCTGGG + Intronic
1173842776 20:46169197-46169219 GCATGTACATGTGTGTCCACTGG - Intergenic
1174136832 20:48385597-48385619 GCATGTGGGTGTGTGTGGTGTGG + Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175314934 20:58040539-58040561 GCATGTGTGTGTGTGGGGTGGGG - Intergenic
1175498897 20:59435436-59435458 CCGGGTGCATGTGTTTGCTGAGG + Intergenic
1175539953 20:59742159-59742181 GCGTGTGAATTTGTGCGCTGGGG + Intronic
1175593320 20:60211153-60211175 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175928758 20:62483659-62483681 GCATATGCATGTGTGTGCACAGG - Intergenic
1176060546 20:63170670-63170692 GCAGCTGAATGTGTCTGCTGGGG - Intergenic
1176106063 20:63388071-63388093 GCATGTGCATATGTGTGTGTGGG - Intergenic
1176207954 20:63900629-63900651 GCATATGCAGGTCTGTCCTGAGG - Intronic
1176366741 21:6037686-6037708 GCTTGTGCCTGAGTGCGCTGGGG - Intergenic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1177662971 21:24111639-24111661 GTATGTGCATGTGTGATGTGTGG + Intergenic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1179004320 21:37497041-37497063 GTATGTACATGTGTGTGTGGGGG - Intronic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1179394478 21:41025322-41025344 GAATGTGCATGCATGTGGTGAGG - Intergenic
1179409415 21:41150913-41150935 CCATGTGTGTGTGTGTGATGGGG + Intergenic
1179556768 21:42183624-42183646 GCATGTGTGTGTGTGTGGTATGG + Intergenic
1179620980 21:42615986-42616008 GTATGTGTTTCTGTGTGCTGTGG - Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179756777 21:43500858-43500880 GCTTGTGCCTGAGTGCGCTGGGG + Intergenic
1179827517 21:43975094-43975116 GCATGTGCCAGTGTGTGCACTGG + Intronic
1180108495 21:45636028-45636050 ATATGTGTATGTGTGTGGTGTGG + Intergenic
1180116468 21:45708908-45708930 GCAGGCCCATGTGTGTGCAGAGG + Intronic
1180195765 21:46192627-46192649 GCATCTGCATATGTGTGCACAGG + Intronic
1180195774 21:46192744-46192766 GCATCTGCATGTGTGTACACAGG + Intronic
1180195783 21:46192861-46192883 GCATCTGCATATGTGTGCACAGG + Intronic
1180195792 21:46192978-46193000 GCATCTGCATGTGTGTACACAGG + Intronic
1180195801 21:46193095-46193117 GCATCTGCATGTGTGTACACAGG + Intronic
1181725452 22:24807726-24807748 GCATGTGTGTGTATGTGTTGGGG + Intronic
1181746312 22:24957179-24957201 GTGTGTGCCTGTGTGTGTTGGGG + Intronic
1182012653 22:27013562-27013584 GCATATGCATGTGTGTGAGAGGG + Intergenic
1182222665 22:28771310-28771332 TTATGTACATGTGTGTGCTTTGG + Intergenic
1182346613 22:29670899-29670921 GGCTGTGCAAGTCTGTGCTGTGG + Intronic
1182594205 22:31405665-31405687 GCATGTGTGTGTGTGTGGGGGGG + Intronic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183233021 22:36594844-36594866 GCATGTGTGTGTGTGTGCATGGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1183426732 22:37743873-37743895 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
1183877665 22:40797843-40797865 CCATGTGCATTTGTTGGCTGCGG - Intronic
1184073697 22:42162830-42162852 GCATGTGCATGTACGTGCTTGGG - Intronic
1184096093 22:42317362-42317384 GCGTGTTTATGTGTGTGGTGGGG + Intronic
1184190803 22:42893189-42893211 GCAAGTGCAAGTGTGTCCTATGG + Intronic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1184516165 22:44964092-44964114 GCAAGAGCATGTGTTTCCTGGGG + Intronic
1184523533 22:45009015-45009037 GCGTGCGCGTGTGTGTGTTGGGG - Intronic
1184821353 22:46911081-46911103 ACATGTGCACGTGTATGGTGTGG + Intronic
1184924652 22:47628761-47628783 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924666 22:47628913-47628935 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1184934209 22:47707161-47707183 GCATGTGCATGTGTGTCCGATGG + Intergenic
1184946872 22:47809938-47809960 GTGTATGTATGTGTGTGCTGTGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185125151 22:49006397-49006419 TTATGTGCATGTGTGTGCGTGGG + Intergenic
949240588 3:1866451-1866473 GCACGTGCATGTGTGTGAGAGGG - Intergenic
949742879 3:7256612-7256634 GCATGTGTGTGTGTGTGCATAGG - Intronic
949920469 3:8996336-8996358 CCTGGTGCATGTGTGTGGTGGGG - Intronic
950096344 3:10333038-10333060 CCATGTGCGTCTGTCTGCTGAGG + Intronic
950111096 3:10419176-10419198 AGATGGGGATGTGTGTGCTGAGG + Intronic
950425856 3:12924417-12924439 GCATCTGCATGTGTGTGTCTAGG + Intronic
951145576 3:19222498-19222520 GCATGTGCATTTGTATACAGAGG + Intronic
951369138 3:21823432-21823454 GCATGTGTGTGTGTGTGTTTGGG - Intronic
951387966 3:22065678-22065700 AAAAGTGTATGTGTGTGCTGTGG + Intronic
951603777 3:24408523-24408545 GCATGAGCATGTGTGTGAGCTGG + Intronic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
953847016 3:46435766-46435788 GCACGTGCATGTATGTGCCTGGG - Exonic
954429897 3:50464972-50464994 CCATGTGCATCTCTGTCCTGAGG - Intronic
954594227 3:51811636-51811658 GTGTGTGCATGTGTGAGGTGTGG - Intergenic
954633707 3:52060158-52060180 CCATATGAATGTGTGTGTTGGGG - Intergenic
955534378 3:59907605-59907627 GTGTGTGCATGTGTGCACTGGGG + Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956537757 3:70297001-70297023 GTATGTGCGTATGTGTGGTGGGG - Intergenic
956638439 3:71390559-71390581 GGATGTGTGTGTGTGTGGTGGGG + Intronic
956816699 3:72914591-72914613 CCATGTGCGTGTGTGTGAGGGGG + Intronic
956853916 3:73257361-73257383 GCTGGTGCATGTGTGAGATGCGG - Intergenic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
959263203 3:104105856-104105878 ACATGTGAATGAGTGGGCTGGGG - Intergenic
959513169 3:107236429-107236451 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
959563067 3:107804769-107804791 CCATGTGCATGTGAGTTCAGAGG + Intronic
959995568 3:112676891-112676913 GCATGTGTGTGTGTGTGTTACGG - Intergenic
960013762 3:112862066-112862088 GTATGTGTCTGTGTGTGGTGGGG - Intergenic
960015914 3:112887685-112887707 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
961109567 3:124272582-124272604 GCATGTGCATGTGAGTAGAGGGG + Intronic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
961667122 3:128499364-128499386 GCAGGGGTATGTGTGTGCGGAGG - Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
961863047 3:129933503-129933525 GCATGTGAGTGTGTGTGAGGAGG + Intergenic
962357667 3:134708824-134708846 GAATGTGTCTGTGTGTGTTGTGG + Intronic
962366785 3:134792113-134792135 GCGTGTGTGTGTGTGTGCAGGGG + Intronic
962508826 3:136077695-136077717 GATTGAGGATGTGTGTGCTGTGG - Intronic
962745044 3:138390661-138390683 GCAGGTGTATGTGTGTGGAGGGG + Intronic
962885910 3:139627655-139627677 GCAGGTGCATGTTGGTGATGGGG + Intronic
963023851 3:140899479-140899501 GCTAGGGCTTGTGTGTGCTGAGG - Intergenic
963343339 3:144064343-144064365 GTATGTGTGTGTGTGTGGTGGGG + Intergenic
964054971 3:152443185-152443207 GCATGTGTGTGTGTGTGGGGGGG - Intronic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
965246532 3:166278714-166278736 GCATCTGCATGAGTTTGCTTAGG - Intergenic
965370476 3:167855943-167855965 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
965543819 3:169895591-169895613 GTGTGTGTCTGTGTGTGCTGGGG + Intergenic
965545689 3:169914184-169914206 AGCTGTGCATGTGTGTGTTGGGG + Intronic
965941443 3:174187446-174187468 GCATTTTCATGTGTGTGCCAGGG - Intronic
966053799 3:175656737-175656759 GTATGTGTGTGTGTGTGCAGGGG + Intronic
966471595 3:180295282-180295304 GTATGTGCGTGTGTGTGTAGGGG - Intergenic
966766087 3:183463872-183463894 ATATGTGCATGTGTGGGGTGGGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967503027 3:190222309-190222331 GCATGTGCGTGTGTGTCGGGGGG + Intergenic
967645474 3:191918000-191918022 TCATGTGCATCTGTTTGCTTGGG + Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967762356 3:193240711-193240733 GCGTGTGTGTGTGTGTGGTGTGG + Intergenic
967773460 3:193359801-193359823 GCATGTGTGTGTGTGTGTGGTGG + Intronic
967987608 3:195107047-195107069 GCAGGTGCCTGTGTGTGTTTGGG - Intronic
968446864 4:656609-656631 TCATGGGCATGTGTGTGGGGCGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968909018 4:3467203-3467225 GCAGGGGCATGTGTGGGCCGGGG - Intronic
968945121 4:3659675-3659697 GCATGTGCCTGTCGGTGCAGAGG - Intergenic
969323268 4:6425918-6425940 GCATGTGCATGTGTGTTGCGGGG + Intronic
969584031 4:8081599-8081621 GCATGTGCATCTGTGTGCATAGG + Intronic
969613451 4:8239389-8239411 GCATGTGCCTGTGTGTACATGGG - Intronic
969686655 4:8679139-8679161 GCTTGTGCTTTTGTGTCCTGTGG + Intergenic
969721929 4:8896783-8896805 GCATGCACTTGTGTGTGCAGAGG - Intergenic
971342523 4:25783637-25783659 GTATGTGCATGTGTGGGTGGGGG + Intronic
971632879 4:29017586-29017608 GCATGTGTATGTGTGTGTGTGGG - Intergenic
971806634 4:31366864-31366886 CCATGTGTAAATGTGTGCTGTGG + Intergenic
972167700 4:36307560-36307582 GAATGTGTATGTGTGTGGGGAGG + Intronic
972782974 4:42301836-42301858 GGATGTGTGTGTGTGTGTTGGGG - Intergenic
972873481 4:43329215-43329237 GTTTGTGTATGTGTGTGTTGGGG + Intergenic
972941653 4:44202731-44202753 GCATGTGCAGGTTTGTTATGTGG - Intronic
973242791 4:47975282-47975304 GCAGGTCCCTGTGTGTGCTGGGG - Intronic
973669432 4:53200806-53200828 GCATGTGTATATGTGTCATGAGG - Intronic
973719342 4:53707461-53707483 CTATGTGCATTTGTTTGCTGGGG + Intronic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974135049 4:57805099-57805121 GCATGTAGATTTGTGTGGTGTGG - Intergenic
974411781 4:61550992-61551014 GTATGTGTATGTGTGTGATTAGG + Intronic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
974637321 4:64581705-64581727 CCATGTGGATGTGAGGGCTGAGG - Intergenic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975607611 4:76171147-76171169 GCATGTGCATGTGAGAGATGAGG - Intronic
975986883 4:80208255-80208277 GTATGTGTATATGTGTGGTGTGG - Intergenic
977656864 4:99532657-99532679 ACATGTGCATGTTTGTTATGTGG - Intronic
978471545 4:109073129-109073151 GCATGTGTATGTGTGTGTGGGGG + Intronic
978471552 4:109073158-109073180 GCATGTGCATGGGTGTTTGGTGG + Intronic
978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG + Intronic
979291166 4:118980513-118980535 GCATGTGTGGGTGTGTGCTGGGG - Intronic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
981107665 4:140899570-140899592 GCATGTGTATGTGTGTGCACAGG + Intronic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
982705120 4:158700551-158700573 GCGTGTGTGTGTGTGTGGTGGGG - Intronic
983007484 4:162501929-162501951 GCATGTGTGTTTGTGTGCTTTGG + Intergenic
983300386 4:165918069-165918091 GCATGTGTATATGTATGCTGTGG - Intronic
983879638 4:172918539-172918561 GTCTGTGAATGTGTGTGTTGGGG - Intronic
984198652 4:176691463-176691485 GCCTGTGTGTGTGTGTGGTGGGG - Intronic
984319778 4:178179027-178179049 GTATGTGTATGTGTGTGGAGGGG - Intergenic
984582868 4:181530809-181530831 GCATGTGCATGTATGTACGTGGG + Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
984642909 4:182189729-182189751 GCGTGTGGGTGTGTGTGTTGGGG + Intronic
985038976 4:185869507-185869529 GAATGTGCGTGTGGGAGCTGAGG - Intronic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985117838 4:186608631-186608653 GTATGAGCATTTGTGAGCTGAGG - Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985581372 5:697074-697096 GCACGTGCCTGTGTGTGTTTGGG + Intergenic
985595996 5:788330-788352 GCATGTGCCTGTGTGTGCATGGG + Intergenic
985596001 5:788400-788422 GCACGTGCCTGTGTGTGTTTGGG + Intergenic
985719892 5:1483295-1483317 GCATGGCCAAGTGTGGGCTGTGG + Intronic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
986026982 5:3859932-3859954 GCCAGTGCATGAGTGTCCTGTGG + Intergenic
986055928 5:4136478-4136500 GCATGTGTTTGTGTATGTTGGGG + Intergenic
986169629 5:5305084-5305106 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986169659 5:5305287-5305309 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986169664 5:5305328-5305350 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986169681 5:5305450-5305472 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986469211 5:8057778-8057800 GACTGTGTATGTGTGTTCTGGGG - Intergenic
986798996 5:11240456-11240478 GTATGTGAGTGTGTGTGTTGGGG - Intronic
987226132 5:15843309-15843331 GCAAATGTGTGTGTGTGCTGTGG - Intronic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
988336217 5:29912003-29912025 GCATGTACATGTTTGTTATGTGG - Intergenic
988912199 5:35854547-35854569 GCATGTGCTGGTTTGTTCTGGGG - Intronic
988995990 5:36715367-36715389 GCATGTGTGTATGTGTGCTGGGG - Intergenic
989082425 5:37637470-37637492 GCATGTGGGTGTGTGAGATGAGG - Intronic
989129866 5:38096581-38096603 GTGCATGCATGTGTGTGCTGGGG + Intergenic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
990355240 5:54960419-54960441 GGTTGTGCAGGTGTGTGCAGTGG - Intergenic
990719152 5:58673769-58673791 GTATCTGCATGTGTTTGATGAGG + Intronic
991069305 5:62458681-62458703 GCCTGTGCATGTGTGTGTCTAGG + Intronic
991449168 5:66733315-66733337 CTCTGTGCATGTGTGTGGTGGGG - Intronic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
993276008 5:85859779-85859801 GCATATGCATGTGTGTACGTAGG + Intergenic
993321158 5:86468879-86468901 GCATGTACATATGTGTACTTAGG + Intergenic
994123697 5:96146659-96146681 GTATGTTAATGTGTTTGCTGTGG - Intergenic
994751310 5:103740349-103740371 GCATGTGTATGTGGGTTGTGTGG + Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995280172 5:110325871-110325893 GCATGTGTGTGTGTATGTTGAGG + Intronic
995602940 5:113818237-113818259 GCATGTGCATGTGTGTATGCAGG + Intergenic
995747020 5:115414860-115414882 GCATGTGTGTGTGTGTGGGGGGG + Intergenic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996317996 5:122182862-122182884 GCATGTGCATAGGCATGCTGGGG + Intergenic
996433480 5:123406890-123406912 GCATGCACATGTGTATGCTGAGG + Intronic
996541083 5:124630497-124630519 GCATGTGTGCGTGTGTGCTAGGG + Intergenic
996833816 5:127769100-127769122 GCATGTAAATGTGTGGGTTGTGG + Intergenic
997074525 5:130656838-130656860 GCATGTGTGTGTGTCTGTTGGGG + Intergenic
997198115 5:131993113-131993135 AAAGGTGCAGGTGTGTGCTGAGG - Intronic
997232034 5:132252476-132252498 GTCTGTGGATGTGTGCGCTGGGG + Intronic
997333768 5:133088267-133088289 GCATGAGTATGTGTGTGTTGCGG + Intronic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
998502328 5:142644427-142644449 ACGTGTGTATGTGTGTGGTGGGG - Intronic
998898041 5:146821178-146821200 GCATGTGCACGTGTTGTCTGTGG - Intronic
999088882 5:148917617-148917639 GCATCTGTATCTGTGTGCTCAGG + Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999319685 5:150605739-150605761 GTATGTGTGTGTGTGTGGTGGGG - Intronic
999533922 5:152495638-152495660 GTATGTGCATGTGTGTGGAATGG - Intergenic
999844291 5:155461507-155461529 GTATGTGCATGTGCGTGTTTGGG - Intergenic
1000408685 5:160915834-160915856 GCAAGTGTATGTGTGTGCAAAGG - Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001007347 5:168064723-168064745 GCATGGGCTGATGTGTGCTGAGG + Intronic
1001297366 5:170507557-170507579 GGACGAGCATCTGTGTGCTGGGG - Intronic
1001936202 5:175707757-175707779 GCATGTGCTTGTGTCTCCTCAGG + Intergenic
1002254995 5:177952049-177952071 GTCTGTGCGTGTGTGTGCTGGGG + Intergenic
1002302673 5:178266381-178266403 GCATATGTGTGTGTGTGTTGGGG + Intronic
1002347474 5:178557908-178557930 GCATGGACAGGGGTGTGCTGAGG + Intronic
1002394893 5:178945026-178945048 GCATGTGTGTGTGTGTGTTGAGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002900074 6:1403878-1403900 GCATGTGCGTGTGTGTGTCTCGG - Intergenic
1002956565 6:1871053-1871075 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003749031 6:9035549-9035571 GTATGTGTATGTGTGTGGGGGGG - Intergenic
1003820908 6:9895939-9895961 GGCTGTGGATGTGTGTGTTGGGG - Intronic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1003985056 6:11427166-11427188 GCATGTGTATGTGTGTTTAGGGG - Intergenic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004324679 6:14664359-14664381 GCCTGTGCAGGTGGCTGCTGAGG + Intergenic
1004754233 6:18594184-18594206 GTAGGTGCATGTCTGTGCTTTGG + Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005423762 6:25679480-25679502 GCAGGTGTGTGTGTGTGCAGGGG + Intronic
1005485765 6:26297825-26297847 GAGTGTGTATGTGTGTGGTGGGG - Intergenic
1005672740 6:28123646-28123668 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1005798162 6:29390607-29390629 GGATGAGCATGTGTGTCCTTGGG + Intronic
1005926413 6:30449213-30449235 GGATGAAAATGTGTGTGCTGTGG + Intergenic
1005928136 6:30461785-30461807 GGATGAAAATGTGTGTGCTGGGG + Intergenic
1006237017 6:32642546-32642568 TCATGTGCATGTGTGTGGGATGG - Intronic
1006247002 6:32746176-32746198 TCATGTGCATGTGTGTGGGATGG - Intronic
1006295414 6:33167924-33167946 GCATGTGTATGTGTGTGTCTAGG - Intronic
1006464639 6:34185336-34185358 GCATGTGTATGTGTGTGGGCGGG - Intergenic
1006520267 6:34567254-34567276 GTGTGTGTATGTGTGTTCTGAGG - Intergenic
1006646870 6:35520992-35521014 GCCTGGGCATGTGTGAGCAGAGG - Intergenic
1006699292 6:35958713-35958735 GCATTTGTGTGTGTGTGTTGCGG + Intronic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007401271 6:41603977-41603999 GCATGTGCATGTGTGTGTGAAGG - Intergenic
1007410036 6:41656181-41656203 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1007707316 6:43798806-43798828 GCGTGTGTGTGTGTGTGCAGGGG + Intergenic
1007834570 6:44664670-44664692 GCATGTGTGTGTGTGTGGGGCGG - Intergenic
1007836483 6:44677886-44677908 ACATGTGCATGTGTGTGCATAGG - Intergenic
1007915122 6:45554247-45554269 GTATGTGTCTGTGTGTGGTGTGG + Intronic
1008408846 6:51149486-51149508 GCACGTGCATGTGTGTGAAGAGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009758226 6:67968840-67968862 GCTTGTGAATGTGTGTTCTGTGG - Intergenic
1010088858 6:71954841-71954863 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1010313296 6:74413888-74413910 GCATGTTCATGTCTATGATGAGG + Intergenic
1010469510 6:76210224-76210246 GCATCTACATGTATGTGGTGAGG - Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011372948 6:86659099-86659121 GTATGTGTGTGTGTGTGCTGAGG - Intergenic
1012388813 6:98713090-98713112 GCATATGAATGTGGGTGCTTAGG - Intergenic
1012422895 6:99084274-99084296 GCATGTCCATGTATGTGTAGAGG + Intergenic
1012950159 6:105509730-105509752 GCATGTGTGTGTGTGTGGGGTGG + Intergenic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1014141152 6:117944572-117944594 GTATGTGTATGTGTGTGTTTTGG - Intronic
1014237349 6:118973247-118973269 GCGTCTGTATGTGTGTGTTGTGG + Intronic
1015395358 6:132727914-132727936 TTGTGTGCATGTGTGTGCTCTGG + Intronic
1015504302 6:133966106-133966128 GCATGTGTGTGTGTGTCGTGTGG + Intronic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016362402 6:143281829-143281851 GCATGTGCAGGTTTGTCCAGTGG - Intronic
1016942317 6:149492983-149493005 GCCTGTGCCTGCCTGTGCTGGGG + Intergenic
1017239676 6:152153339-152153361 GGATGGACATGGGTGTGCTGGGG - Intronic
1017304105 6:152896720-152896742 GCGTGTGCGTCTGTGTGGTGCGG - Intergenic
1017326155 6:153143510-153143532 GCATGTTCATGGGTGTGGTGAGG + Intergenic
1017406956 6:154129847-154129869 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1017539507 6:155385737-155385759 ACAAGTGTGTGTGTGTGCTGTGG + Intergenic
1017543505 6:155427013-155427035 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1017573300 6:155771993-155772015 GCATGTCTGTGTGTCTGCTGGGG + Intergenic
1018244104 6:161805437-161805459 GTGTGTGCATGTGTGTACTCAGG - Intronic
1018296948 6:162358146-162358168 GAAAGTGTATGTGTGTGTTGGGG + Intronic
1018723337 6:166590617-166590639 GCACGTGCGTGTGTGTGTTGTGG - Intronic
1018788175 6:167124935-167124957 GTATTTGCATGTGTGTGCATGGG - Intronic
1018837092 6:167493350-167493372 GCATGGGAATGTGTGTGCATGGG - Intergenic
1018837118 6:167493587-167493609 GCATGTGAGTGTGTGTGCATGGG - Intergenic
1019135840 6:169907150-169907172 GCATGTGCCTGTGTGTACAGGGG - Intergenic
1019352977 7:563741-563763 GTATGTACGTGTGTGTGCTCAGG + Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019581672 7:1766998-1767020 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1020672862 7:11140143-11140165 GTATGTACAGGTGTGTGCAGGGG - Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021840100 7:24715344-24715366 CCCTCTGCATGTGTGTGGTGAGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022410606 7:30135965-30135987 GCATGTGTGTGTGTGTGTTGGGG - Intronic
1022556987 7:31307976-31307998 GCATGCACATGTGCATGCTGAGG + Intergenic
1022738005 7:33093900-33093922 ACAGGAGCATGTGTGGGCTGTGG + Intergenic
1023111980 7:36822855-36822877 GCATGTGTATGTGTGTTCATGGG + Intergenic
1023441508 7:40189438-40189460 ACATGTGCATGTTTGTTATGTGG + Intronic
1024362095 7:48478909-48478931 GCATGTGTTTGTGTGTGTTGAGG + Intronic
1025069169 7:55883987-55884009 GCATGTGTTTGTGTGTGGCGGGG - Intergenic
1026077329 7:67184301-67184323 GCATGTTCCTGTGTATCCTGTGG + Intronic
1026191638 7:68133806-68133828 GTATGTGTGTGTGTGTGTTGTGG - Intergenic
1026447268 7:70496021-70496043 ACGTGTGCATGTGTGTGGGGGGG - Intronic
1026807415 7:73436809-73436831 CCATGTCCATCTGTGTGCTGGGG + Intergenic
1027350807 7:77309229-77309251 GCCTGGGTATGTGTCTGCTGAGG + Intronic
1027409838 7:77904794-77904816 GCATATGCATTTGTGTGGGGAGG + Intronic
1027459834 7:78438515-78438537 CCTTCAGCATGTGTGTGCTGCGG + Intronic
1028889198 7:95967902-95967924 GTATGTGCATGCTTGTGCGGGGG + Intronic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1029913017 7:104174895-104174917 GGCTGTCCATGTGTGTGCAGTGG - Intronic
1030110157 7:106020033-106020055 GCATGTGTGTGTGTGTGGGGGGG + Intronic
1030987469 7:116259386-116259408 ACATGTGCATGTGTGTGTGGTGG - Intergenic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032072997 7:128821165-128821187 GCATGTGCTAGAGTATGCTGAGG - Intronic
1032532585 7:132634457-132634479 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1033639330 7:143246051-143246073 GCGTGTGTGTGTGTGTGTTGAGG - Intronic
1034120174 7:148619863-148619885 ACAGGTGCATGTGTTTCCTGAGG - Intergenic
1034521481 7:151623896-151623918 CAATGCGCATGTGTGTACTGGGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1034876848 7:154732400-154732422 GCATATGCATGTGACTGCTTTGG - Intronic
1035245027 7:157557326-157557348 GGATGTGCATGTGTGATGTGGGG - Intronic
1035351387 7:158248599-158248621 GTATGTGCATGTATGTGATGTGG - Intronic
1035351400 7:158248833-158248855 GTATGTGCATGTATGTGACGTGG - Intronic
1035351405 7:158248946-158248968 GTATGTGCATGTATGTGATGTGG - Intronic
1035360734 7:158312437-158312459 GCATGTGAATGAGTGCGCAGGGG - Intronic
1035360780 7:158312928-158312950 GCATGTCAATGAGTGTGCAGGGG + Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035429909 7:158811593-158811615 GCAGGTGTGTGTGTGAGCTGTGG - Intronic
1035617060 8:1010160-1010182 GCATGTGTCTGTGTGTGCATAGG - Intergenic
1035975701 8:4308399-4308421 GCATGTGTGTGTGTGTTATGTGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036212126 8:6850833-6850855 GCATGTGCAGGTGTGTGTATGGG - Intergenic
1036415923 8:8548531-8548553 GGCTGTTCATGTCTGTGCTGTGG + Intergenic
1036632233 8:10523993-10524015 CCAGGTGCCTGGGTGTGCTGTGG + Intergenic
1036766526 8:11552879-11552901 GCATGTGTATGTGCGTGTGGTGG - Intronic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1037895662 8:22652505-22652527 GCATGTGCGCATGTGTGGTGGGG + Intronic
1037931036 8:22880603-22880625 GCAGGTGCATGTGGGCTCTGGGG + Intronic
1037992814 8:23332691-23332713 GCATGTGTATGAGTGTGTGGGGG - Intronic
1038835612 8:31118236-31118258 GTATATGCATGTATGTGTTGCGG + Intronic
1039359670 8:36862558-36862580 GAAGGTGCATGTGTGTGGGGTGG - Intronic
1039364816 8:36918593-36918615 GTATGTGTGTGTGTGTGGTGGGG - Intronic
1039765507 8:40624072-40624094 GTATGTGTATGTGTCTGCTATGG + Intronic
1040028742 8:42805092-42805114 GCATGTGCATGGGGGTGCAGTGG - Intergenic
1040628544 8:49180819-49180841 GGATGTGCATGTGTGTGTGTTGG - Intergenic
1041551833 8:59111577-59111599 GCATGTGTATGGGTGTGTGGGGG - Intronic
1041709002 8:60876159-60876181 GCATGGTCCTGAGTGTGCTGGGG - Intergenic
1042023966 8:64402905-64402927 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1042780710 8:72487929-72487951 ATATGTGCATGTTTGTGATGAGG - Intergenic
1043880675 8:85539187-85539209 GCATCTGTATGTGGGAGCTGTGG - Intergenic
1044146723 8:88725125-88725147 GAATGTGCATGTTTTTGCAGGGG + Intergenic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1044533978 8:93338882-93338904 GCATGTGTATTTGTTTGCTAGGG + Intergenic
1045192561 8:99897137-99897159 GCATGTTCCTGGGTGTGCTGCGG - Intergenic
1045375080 8:101564423-101564445 GCACGTGCATGTGTGCACAGTGG + Intronic
1045844864 8:106622448-106622470 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1046808831 8:118510209-118510231 GTATGTGTGTGTGTGTGGTGGGG - Intronic
1047067733 8:121305076-121305098 GCATGTGTGTGTGTGTGTTTTGG + Intergenic
1047136431 8:122083928-122083950 GCATGTGTCTGTGTGTGGTGTGG + Intergenic
1047591742 8:126334428-126334450 GTGTGTGTGTGTGTGTGCTGTGG - Intergenic
1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG + Intergenic
1047852730 8:128876387-128876409 GTATGTGTTTGTGTGTGTTGTGG - Intergenic
1048012644 8:130470493-130470515 ACACGTGCATGTGTGTGTTTAGG + Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048287995 8:133157296-133157318 ACATGAGCATGGGAGTGCTGAGG + Intergenic
1048693565 8:136996331-136996353 TGATGTGTATGTGTGTGCGGAGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048994215 8:139781720-139781742 GTGTGTGCCTGTGTGTGCGGTGG + Intronic
1049355996 8:142188360-142188382 CCATGTGCAGGTGTGTGCTACGG - Intergenic
1049392828 8:142380942-142380964 GCAGGTGCATGTGTGTGTGGGGG - Intronic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050253827 9:3773491-3773513 GTATGTGCATGTGTATGTAGAGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1050388998 9:5117138-5117160 GCAGGTTCAGGTGTGTGGTGAGG - Intronic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1052999529 9:34569966-34569988 TCAAGTGTAGGTGTGTGCTGGGG - Intronic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1053504376 9:38628920-38628942 GTATGAATATGTGTGTGCTGGGG - Intergenic
1055196277 9:73598415-73598437 GCATGTGTATGTGTCTATTGGGG - Intergenic
1055424569 9:76180979-76181001 GTATGTGCATGTGTGAGTGGTGG - Intronic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1055839039 9:80480511-80480533 GTGTGTACATGTGTGTGGTGAGG + Intergenic
1056125461 9:83532610-83532632 GCATGCACATGTGTGTGGTGGGG - Intronic
1056178668 9:84060826-84060848 GCGTGTGAATGTGTGAGCTCAGG + Intergenic
1056193035 9:84203597-84203619 GGTTGTGCATGTGTGGGCTAAGG + Intergenic
1056298921 9:85221812-85221834 ACATGTGCAGGTTTGTGATGTGG - Intergenic
1056575169 9:87850808-87850830 GCATGTACATGTGTGTGTATTGG - Intergenic
1056693579 9:88827957-88827979 GCATGCGGATGCATGTGCTGAGG + Intergenic
1056782704 9:89563257-89563279 GCACGTGCATAGGTGTGCTGAGG - Intergenic
1056859360 9:90165492-90165514 GCGTGTGTGTGTGTGTGGTGTGG + Intergenic
1057335448 9:94151524-94151546 GAATGTGTGTGTGTGTGCGGGGG + Intergenic
1058327164 9:103713145-103713167 GTATGTGCGTGTGTGAGCTGGGG - Intergenic
1058495187 9:105550965-105550987 GCACGTGAATGTGTTTGCTTTGG + Intronic
1058513193 9:105741645-105741667 GAATGTGGATGTTTTTGCTGAGG + Intronic
1058595855 9:106614931-106614953 GCATGTGAATGTGAGAGTTGGGG + Intergenic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1060662026 9:125410236-125410258 GTATGTGTGTGTGTGTGGTGTGG - Intergenic
1060721709 9:125983963-125983985 GCATGTCCCTGTGTGCACTGTGG + Intergenic
1060816310 9:126637314-126637336 GTGTGTCCCTGTGTGTGCTGTGG + Intronic
1060816335 9:126637456-126637478 GCGTGTGCATTTGTGTGTGGGGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1061526124 9:131164221-131164243 ACGTGTGCATGTGTGAGCTAGGG + Intronic
1062011413 9:134268951-134268973 GCAAGTGAATGTGACTGCTGTGG - Intergenic
1062130144 9:134888217-134888239 GCAGGAGCTTGTGTCTGCTGAGG + Intergenic
1062195313 9:135269911-135269933 ATGTGGGCATGTGTGTGCTGTGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062316155 9:135967952-135967974 GCATGTTCATGTGTGCGGGGGGG + Intergenic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062388508 9:136324783-136324805 GCAGGGCCCTGTGTGTGCTGGGG + Intergenic
1062553498 9:137101755-137101777 GTATGTGCATGTGTGTTTTCAGG + Intronic
1185465351 X:351149-351171 GCACGTGCCTGTGCGTCCTGCGG - Intronic
1185518452 X:718520-718542 GGCTGTGCATGTGTGTGAGGTGG + Intergenic
1186037562 X:5441281-5441303 GGCTGTGCATGTGTGTGGGGAGG + Intergenic
1186404779 X:9292384-9292406 GCATGTGCATGTGTGTATATGGG - Intergenic
1186600359 X:11030236-11030258 GCATGTACATGTGTGTGTAGTGG - Intergenic
1186860660 X:13669444-13669466 ACAAGTGCCTGGGTGTGCTGTGG - Intronic
1187100790 X:16189227-16189249 GCATTTGTATGTCTGGGCTGGGG + Intergenic
1187231640 X:17429200-17429222 GCATCTGCCTGTGTGTACTGGGG + Intronic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187762982 X:22608232-22608254 ACATGTGTATATGTGTGCCGTGG - Intergenic
1187955067 X:24509485-24509507 GTATGTGTATGTGTGTGTTGGGG - Intronic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1188680125 X:32993706-32993728 GCATGTGTCTGTGTGTTTTGGGG + Intronic
1189204686 X:39227575-39227597 GCGTGTGTGTGTGTGTGGTGGGG - Intergenic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1189267307 X:39726728-39726750 GCATGTGTATGTGTGTGTCTGGG + Intergenic
1189558302 X:42167187-42167209 GCATGTGTAGGTGTGTGGTAGGG - Intergenic
1189653159 X:43211555-43211577 GCATGTGCATGCTTGTGGGGTGG - Intergenic
1189778526 X:44491867-44491889 TGATATGTATGTGTGTGCTGGGG - Intergenic
1191049398 X:56175138-56175160 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1193653396 X:84167788-84167810 GTATGTGTGTGTGTGTGCTGGGG + Intronic
1194426381 X:93743629-93743651 GCATGTGCATGTGTGTATATTGG + Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1194634602 X:96329198-96329220 GCATATGCATATGAGTGCTATGG + Intergenic
1194866859 X:99079407-99079429 ACATGTGCATGTGTGTGTCGGGG - Intergenic
1195716591 X:107824974-107824996 GCGTGTGTGTGTGTGTGCTGGGG + Intergenic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196427877 X:115590389-115590411 GTATGTGCATGTGTGTGAACAGG - Intronic
1196611781 X:117723434-117723456 CCATGTGCATGTGTGTATTGTGG + Intergenic
1196644713 X:118105080-118105102 ATATGTGCATGTGTGTGCACAGG - Intronic
1197292302 X:124673783-124673805 GCATGTGTATAGGTGTGCTGTGG + Intronic
1197631913 X:128870763-128870785 GTATGTGCATATATGTGTTGGGG - Intergenic
1197653197 X:129087233-129087255 GCCTGGGTATGTGTCTGCTGGGG - Intergenic
1198480753 X:137037680-137037702 GAATGTGTGTGTGTGTGGTGGGG + Intergenic
1199911235 X:152289270-152289292 AAATGTGCATGATTGTGCTGGGG - Intronic
1200022403 X:153223076-153223098 GTATGTGCATGTGAGTGTGGAGG - Intergenic