ID: 1152091699

View in Genome Browser
Species Human (GRCh38)
Location 17:78250952-78250974
Sequence GGGGCCCAGTGCCCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152091699_1152091709 28 Left 1152091699 17:78250952-78250974 CCAGCTGGGGGGCACTGGGCCCC No data
Right 1152091709 17:78251003-78251025 TCTGGCTCCCGTCGGGAGCGCGG No data
1152091699_1152091706 10 Left 1152091699 17:78250952-78250974 CCAGCTGGGGGGCACTGGGCCCC No data
Right 1152091706 17:78250985-78251007 ACTCTTCAGATGCTGCTGTCTGG No data
1152091699_1152091707 20 Left 1152091699 17:78250952-78250974 CCAGCTGGGGGGCACTGGGCCCC No data
Right 1152091707 17:78250995-78251017 TGCTGCTGTCTGGCTCCCGTCGG No data
1152091699_1152091710 29 Left 1152091699 17:78250952-78250974 CCAGCTGGGGGGCACTGGGCCCC No data
Right 1152091710 17:78251004-78251026 CTGGCTCCCGTCGGGAGCGCGGG No data
1152091699_1152091708 21 Left 1152091699 17:78250952-78250974 CCAGCTGGGGGGCACTGGGCCCC No data
Right 1152091708 17:78250996-78251018 GCTGCTGTCTGGCTCCCGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152091699 Original CRISPR GGGGCCCAGTGCCCCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr