ID: 1152093228

View in Genome Browser
Species Human (GRCh38)
Location 17:78258274-78258296
Sequence CAGGACACACCAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152093228_1152093240 27 Left 1152093228 17:78258274-78258296 CCCTCCTCCTTTGGTGTGTCCTG No data
Right 1152093240 17:78258324-78258346 GGACTCAGTAAACACCAGCCAGG No data
1152093228_1152093233 -2 Left 1152093228 17:78258274-78258296 CCCTCCTCCTTTGGTGTGTCCTG No data
Right 1152093233 17:78258295-78258317 TGCATGCCTAGCCCAGTGCCAGG No data
1152093228_1152093235 6 Left 1152093228 17:78258274-78258296 CCCTCCTCCTTTGGTGTGTCCTG No data
Right 1152093235 17:78258303-78258325 TAGCCCAGTGCCAGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152093228 Original CRISPR CAGGACACACCAAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr