ID: 1152093401

View in Genome Browser
Species Human (GRCh38)
Location 17:78258914-78258936
Sequence TAGGGCGCTATAGATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152093401_1152093413 14 Left 1152093401 17:78258914-78258936 CCTGCAGGATCTATAGCGCCCTA No data
Right 1152093413 17:78258951-78258973 CCGATAGCTTGGGATCCAGAGGG No data
1152093401_1152093415 24 Left 1152093401 17:78258914-78258936 CCTGCAGGATCTATAGCGCCCTA No data
Right 1152093415 17:78258961-78258983 GGGATCCAGAGGGGAGTTGTCGG No data
1152093401_1152093406 4 Left 1152093401 17:78258914-78258936 CCTGCAGGATCTATAGCGCCCTA No data
Right 1152093406 17:78258941-78258963 AAGCCCAGCCCCGATAGCTTGGG No data
1152093401_1152093405 3 Left 1152093401 17:78258914-78258936 CCTGCAGGATCTATAGCGCCCTA No data
Right 1152093405 17:78258940-78258962 TAAGCCCAGCCCCGATAGCTTGG No data
1152093401_1152093414 15 Left 1152093401 17:78258914-78258936 CCTGCAGGATCTATAGCGCCCTA No data
Right 1152093414 17:78258952-78258974 CGATAGCTTGGGATCCAGAGGGG No data
1152093401_1152093411 13 Left 1152093401 17:78258914-78258936 CCTGCAGGATCTATAGCGCCCTA No data
Right 1152093411 17:78258950-78258972 CCCGATAGCTTGGGATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152093401 Original CRISPR TAGGGCGCTATAGATCCTGC AGG (reversed) Intergenic
No off target data available for this crispr