ID: 1152094489

View in Genome Browser
Species Human (GRCh38)
Location 17:78265231-78265253
Sequence CATCCTGCCATCCTAGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152094489_1152094494 -1 Left 1152094489 17:78265231-78265253 CCAAGGTCTAGGATGGCAGGATG No data
Right 1152094494 17:78265253-78265275 GAAGGAAGGTCCCACATTTGGGG No data
1152094489_1152094498 13 Left 1152094489 17:78265231-78265253 CCAAGGTCTAGGATGGCAGGATG No data
Right 1152094498 17:78265267-78265289 CATTTGGGGACCTGCAGGACAGG No data
1152094489_1152094500 27 Left 1152094489 17:78265231-78265253 CCAAGGTCTAGGATGGCAGGATG No data
Right 1152094500 17:78265281-78265303 CAGGACAGGCTGCAACAGAAAGG No data
1152094489_1152094495 8 Left 1152094489 17:78265231-78265253 CCAAGGTCTAGGATGGCAGGATG No data
Right 1152094495 17:78265262-78265284 TCCCACATTTGGGGACCTGCAGG No data
1152094489_1152094492 -3 Left 1152094489 17:78265231-78265253 CCAAGGTCTAGGATGGCAGGATG No data
Right 1152094492 17:78265251-78265273 ATGAAGGAAGGTCCCACATTTGG No data
1152094489_1152094493 -2 Left 1152094489 17:78265231-78265253 CCAAGGTCTAGGATGGCAGGATG No data
Right 1152094493 17:78265252-78265274 TGAAGGAAGGTCCCACATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152094489 Original CRISPR CATCCTGCCATCCTAGACCT TGG (reversed) Intergenic
No off target data available for this crispr