ID: 1152094496

View in Genome Browser
Species Human (GRCh38)
Location 17:78265263-78265285
Sequence TCCTGCAGGTCCCCAAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152094496_1152094504 21 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094504 17:78265307-78265329 AGTTTAATGAGTAGCATGGGCGG No data
1152094496_1152094505 22 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094505 17:78265308-78265330 GTTTAATGAGTAGCATGGGCGGG No data
1152094496_1152094500 -5 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094500 17:78265281-78265303 CAGGACAGGCTGCAACAGAAAGG No data
1152094496_1152094503 18 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094503 17:78265304-78265326 CCTAGTTTAATGAGTAGCATGGG No data
1152094496_1152094501 17 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094501 17:78265303-78265325 GCCTAGTTTAATGAGTAGCATGG No data
1152094496_1152094506 27 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094506 17:78265313-78265335 ATGAGTAGCATGGGCGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152094496 Original CRISPR TCCTGCAGGTCCCCAAATGT GGG (reversed) Intergenic
No off target data available for this crispr