ID: 1152094501

View in Genome Browser
Species Human (GRCh38)
Location 17:78265303-78265325
Sequence GCCTAGTTTAATGAGTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152094497_1152094501 16 Left 1152094497 17:78265264-78265286 CCACATTTGGGGACCTGCAGGAC No data
Right 1152094501 17:78265303-78265325 GCCTAGTTTAATGAGTAGCATGG No data
1152094499_1152094501 3 Left 1152094499 17:78265277-78265299 CCTGCAGGACAGGCTGCAACAGA No data
Right 1152094501 17:78265303-78265325 GCCTAGTTTAATGAGTAGCATGG No data
1152094496_1152094501 17 Left 1152094496 17:78265263-78265285 CCCACATTTGGGGACCTGCAGGA No data
Right 1152094501 17:78265303-78265325 GCCTAGTTTAATGAGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152094501 Original CRISPR GCCTAGTTTAATGAGTAGCA TGG Intergenic
No off target data available for this crispr