ID: 1152095058

View in Genome Browser
Species Human (GRCh38)
Location 17:78267913-78267935
Sequence GGCCATTGCCCTTTTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152095049_1152095058 12 Left 1152095049 17:78267878-78267900 CCGCATCTCTCAGCAGCAACCCA No data
Right 1152095058 17:78267913-78267935 GGCCATTGCCCTTTTCTGGTGGG No data
1152095055_1152095058 -8 Left 1152095055 17:78267898-78267920 CCAGGACTTAAGGAGGGCCATTG No data
Right 1152095058 17:78267913-78267935 GGCCATTGCCCTTTTCTGGTGGG No data
1152095054_1152095058 -7 Left 1152095054 17:78267897-78267919 CCCAGGACTTAAGGAGGGCCATT No data
Right 1152095058 17:78267913-78267935 GGCCATTGCCCTTTTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152095058 Original CRISPR GGCCATTGCCCTTTTCTGGT GGG Intergenic
No off target data available for this crispr