ID: 1152097812

View in Genome Browser
Species Human (GRCh38)
Location 17:78282109-78282131
Sequence TCCCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020377
Summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152097812_1152097823 24 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097823 17:78282156-78282178 TCAAGGTATCGAGATCAGGCCGG No data
1152097812_1152097825 30 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data
1152097812_1152097819 1 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097819 17:78282133-78282155 GCCAAGGCGGACGGATCATGAGG 0: 23
1: 976
2: 8732
3: 38470
4: 59631
1152097812_1152097821 7 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097821 17:78282139-78282161 GCGGACGGATCATGAGGTCAAGG No data
1152097812_1152097824 25 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097824 17:78282157-78282179 CAAGGTATCGAGATCAGGCCGGG No data
1152097812_1152097822 20 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097822 17:78282152-78282174 GAGGTCAAGGTATCGAGATCAGG No data
1152097812_1152097818 -8 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097818 17:78282124-78282146 CTTTGGGAGGCCAAGGCGGACGG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152097812 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr