ID: 1152097814

View in Genome Browser
Species Human (GRCh38)
Location 17:78282117-78282139
Sequence CCTTGGCCTCCCAAAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 770729
Summary {0: 84285, 1: 209100, 2: 236161, 3: 152470, 4: 88713}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152097814_1152097819 -7 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097819 17:78282133-78282155 GCCAAGGCGGACGGATCATGAGG 0: 23
1: 976
2: 8732
3: 38470
4: 59631
1152097814_1152097822 12 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097822 17:78282152-78282174 GAGGTCAAGGTATCGAGATCAGG No data
1152097814_1152097824 17 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097824 17:78282157-78282179 CAAGGTATCGAGATCAGGCCGGG No data
1152097814_1152097825 22 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data
1152097814_1152097823 16 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097823 17:78282156-78282178 TCAAGGTATCGAGATCAGGCCGG No data
1152097814_1152097826 25 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097826 17:78282165-78282187 CGAGATCAGGCCGGGCACGGTGG No data
1152097814_1152097821 -1 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097821 17:78282139-78282161 GCGGACGGATCATGAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152097814 Original CRISPR CCTTGGCCTCCCAAAGTGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr