ID: 1152097820

View in Genome Browser
Species Human (GRCh38)
Location 17:78282134-78282156
Sequence ACCTCATGATCCGTCCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135322
Summary {0: 72, 1: 3272, 2: 28955, 3: 50432, 4: 52591}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152097820_1152097824 0 Left 1152097820 17:78282134-78282156 CCAAGGCGGACGGATCATGAGGT 0: 72
1: 3272
2: 28955
3: 50432
4: 52591
Right 1152097824 17:78282157-78282179 CAAGGTATCGAGATCAGGCCGGG No data
1152097820_1152097825 5 Left 1152097820 17:78282134-78282156 CCAAGGCGGACGGATCATGAGGT 0: 72
1: 3272
2: 28955
3: 50432
4: 52591
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data
1152097820_1152097823 -1 Left 1152097820 17:78282134-78282156 CCAAGGCGGACGGATCATGAGGT 0: 72
1: 3272
2: 28955
3: 50432
4: 52591
Right 1152097823 17:78282156-78282178 TCAAGGTATCGAGATCAGGCCGG No data
1152097820_1152097822 -5 Left 1152097820 17:78282134-78282156 CCAAGGCGGACGGATCATGAGGT 0: 72
1: 3272
2: 28955
3: 50432
4: 52591
Right 1152097822 17:78282152-78282174 GAGGTCAAGGTATCGAGATCAGG No data
1152097820_1152097826 8 Left 1152097820 17:78282134-78282156 CCAAGGCGGACGGATCATGAGGT 0: 72
1: 3272
2: 28955
3: 50432
4: 52591
Right 1152097826 17:78282165-78282187 CGAGATCAGGCCGGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152097820 Original CRISPR ACCTCATGATCCGTCCGCCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr