ID: 1152097825

View in Genome Browser
Species Human (GRCh38)
Location 17:78282162-78282184
Sequence TATCGAGATCAGGCCGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152097814_1152097825 22 Left 1152097814 17:78282117-78282139 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data
1152097820_1152097825 5 Left 1152097820 17:78282134-78282156 CCAAGGCGGACGGATCATGAGGT 0: 72
1: 3272
2: 28955
3: 50432
4: 52591
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data
1152097816_1152097825 21 Left 1152097816 17:78282118-78282140 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data
1152097812_1152097825 30 Left 1152097812 17:78282109-78282131 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152097825 Original CRISPR TATCGAGATCAGGCCGGGCA CGG Intergenic
No off target data available for this crispr