ID: 1152099457

View in Genome Browser
Species Human (GRCh38)
Location 17:78292520-78292542
Sequence ATGGAGAGGGCAGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152099457_1152099471 27 Left 1152099457 17:78292520-78292542 CCCTCCTCATCTGCCCTCTCCAT No data
Right 1152099471 17:78292570-78292592 TCAGGTTGGTGTCCAAGCCACGG No data
1152099457_1152099469 13 Left 1152099457 17:78292520-78292542 CCCTCCTCATCTGCCCTCTCCAT No data
Right 1152099469 17:78292556-78292578 ATGTCTCCAACATCTCAGGTTGG No data
1152099457_1152099467 9 Left 1152099457 17:78292520-78292542 CCCTCCTCATCTGCCCTCTCCAT No data
Right 1152099467 17:78292552-78292574 CTCCATGTCTCCAACATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152099457 Original CRISPR ATGGAGAGGGCAGATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr