ID: 1152100312

View in Genome Browser
Species Human (GRCh38)
Location 17:78297638-78297660
Sequence CCTCCTGGACTTTGTACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152100306_1152100312 -6 Left 1152100306 17:78297621-78297643 CCCAGTGGAGCAGGAGTCCTCCT No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data
1152100307_1152100312 -7 Left 1152100307 17:78297622-78297644 CCAGTGGAGCAGGAGTCCTCCTG No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data
1152100298_1152100312 19 Left 1152100298 17:78297596-78297618 CCCCCACAAGCAGTGGGGAGAGG No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data
1152100301_1152100312 17 Left 1152100301 17:78297598-78297620 CCCACAAGCAGTGGGGAGAGGTC No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data
1152100305_1152100312 -5 Left 1152100305 17:78297620-78297642 CCCCAGTGGAGCAGGAGTCCTCC No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data
1152100302_1152100312 16 Left 1152100302 17:78297599-78297621 CCACAAGCAGTGGGGAGAGGTCC No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data
1152100300_1152100312 18 Left 1152100300 17:78297597-78297619 CCCCACAAGCAGTGGGGAGAGGT No data
Right 1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152100312 Original CRISPR CCTCCTGGACTTTGTACCTG GGG Intergenic
No off target data available for this crispr