ID: 1152104011

View in Genome Browser
Species Human (GRCh38)
Location 17:78318506-78318528
Sequence GGGACCAGTTGGAGTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152104011_1152104015 -8 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104015 17:78318521-78318543 CTGGTCCCAGATGCATCAGAGGG No data
1152104011_1152104014 -9 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104014 17:78318520-78318542 ACTGGTCCCAGATGCATCAGAGG No data
1152104011_1152104018 1 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104018 17:78318530-78318552 GATGCATCAGAGGGTGACCCTGG No data
1152104011_1152104025 30 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data
1152104011_1152104021 17 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104021 17:78318546-78318568 ACCCTGGGAGGCCAGTCCTTAGG No data
1152104011_1152104019 2 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104019 17:78318531-78318553 ATGCATCAGAGGGTGACCCTGGG No data
1152104011_1152104020 5 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152104011 Original CRISPR GGGACCAGTTGGAGTGGCTC TGG (reversed) Intergenic
No off target data available for this crispr