ID: 1152104013

View in Genome Browser
Species Human (GRCh38)
Location 17:78318517-78318539
Sequence CTGATGCATCTGGGACCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152104013_1152104025 19 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data
1152104013_1152104018 -10 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104018 17:78318530-78318552 GATGCATCAGAGGGTGACCCTGG No data
1152104013_1152104021 6 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104021 17:78318546-78318568 ACCCTGGGAGGCCAGTCCTTAGG No data
1152104013_1152104019 -9 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104019 17:78318531-78318553 ATGCATCAGAGGGTGACCCTGGG No data
1152104013_1152104020 -6 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152104013 Original CRISPR CTGATGCATCTGGGACCAGT TGG (reversed) Intergenic
No off target data available for this crispr