ID: 1152104019

View in Genome Browser
Species Human (GRCh38)
Location 17:78318531-78318553
Sequence ATGCATCAGAGGGTGACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152104012_1152104019 -4 Left 1152104012 17:78318512-78318534 CCACTCCAACTGGTCCCAGATGC No data
Right 1152104019 17:78318531-78318553 ATGCATCAGAGGGTGACCCTGGG No data
1152104011_1152104019 2 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104019 17:78318531-78318553 ATGCATCAGAGGGTGACCCTGGG No data
1152104013_1152104019 -9 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104019 17:78318531-78318553 ATGCATCAGAGGGTGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152104019 Original CRISPR ATGCATCAGAGGGTGACCCT GGG Intergenic
No off target data available for this crispr