ID: 1152104020

View in Genome Browser
Species Human (GRCh38)
Location 17:78318534-78318556
Sequence CATCAGAGGGTGACCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152104012_1152104020 -1 Left 1152104012 17:78318512-78318534 CCACTCCAACTGGTCCCAGATGC No data
Right 1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG No data
1152104013_1152104020 -6 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG No data
1152104011_1152104020 5 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152104020 Original CRISPR CATCAGAGGGTGACCCTGGG AGG Intergenic
No off target data available for this crispr