ID: 1152104025

View in Genome Browser
Species Human (GRCh38)
Location 17:78318559-78318581
Sequence AGTCCTTAGGCAGCTGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152104013_1152104025 19 Left 1152104013 17:78318517-78318539 CCAACTGGTCCCAGATGCATCAG No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data
1152104017_1152104025 9 Left 1152104017 17:78318527-78318549 CCAGATGCATCAGAGGGTGACCC No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data
1152104011_1152104025 30 Left 1152104011 17:78318506-78318528 CCAGAGCCACTCCAACTGGTCCC No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data
1152104016_1152104025 10 Left 1152104016 17:78318526-78318548 CCCAGATGCATCAGAGGGTGACC No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data
1152104012_1152104025 24 Left 1152104012 17:78318512-78318534 CCACTCCAACTGGTCCCAGATGC No data
Right 1152104025 17:78318559-78318581 AGTCCTTAGGCAGCTGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152104025 Original CRISPR AGTCCTTAGGCAGCTGCCTA AGG Intergenic
No off target data available for this crispr