ID: 1152106290

View in Genome Browser
Species Human (GRCh38)
Location 17:78331066-78331088
Sequence CAGGAGCCGGCACGTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152106290_1152106295 0 Left 1152106290 17:78331066-78331088 CCACTACCACGTGCCGGCTCCTG No data
Right 1152106295 17:78331089-78331111 TCTCCCGGATTCTCCCTTGCAGG No data
1152106290_1152106300 19 Left 1152106290 17:78331066-78331088 CCACTACCACGTGCCGGCTCCTG No data
Right 1152106300 17:78331108-78331130 CAGGCCTCGCCGTCTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152106290 Original CRISPR CAGGAGCCGGCACGTGGTAG TGG (reversed) Intergenic
No off target data available for this crispr