ID: 1152111368

View in Genome Browser
Species Human (GRCh38)
Location 17:78359359-78359381
Sequence GCTGCCCGGGGCCACCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152111368_1152111380 13 Too many individual off targets Left 1152111368 17:78359359-78359381 CCGGCAGGGTGGCCCCGGGCAGC 0: 1
1: 1
2: 3
3: 41
4: 437
Right 1152111380 17:78359395-78359417 CGCACTGCAAGGGCGCAGCGTGG 0: 1
1: 0
2: 4
3: 162
4: 2582
1152111368_1152111376 2 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1152111368 17:78359359-78359381 CCGGCAGGGTGGCCCCGGGCAGC 0: 1
1: 1
2: 3
3: 41
4: 437
Right 1152111376 17:78359384-78359406 CTTCCCAGGCGCGCACTGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 99
1152111368_1152111382 28 Complete closest: 632
total_pairs: 3
max_distance: 1000
Left 1152111368 17:78359359-78359381 CCGGCAGGGTGGCCCCGGGCAGC 0: 1
1: 1
2: 3
3: 41
4: 437
Right 1152111382 17:78359410-78359432 CAGCGTGGGAAACTCGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 26
1152111368_1152111377 3 Complete closest: 551
total_pairs: 2
max_distance: 1000
Left 1152111368 17:78359359-78359381 CCGGCAGGGTGGCCCCGGGCAGC 0: 1
1: 1
2: 3
3: 41
4: 437
Right 1152111377 17:78359385-78359407 TTCCCAGGCGCGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 0
4: 85
1152111368_1152111381 14 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1152111368 17:78359359-78359381 CCGGCAGGGTGGCCCCGGGCAGC 0: 1
1: 1
2: 3
3: 41
4: 437
Right 1152111381 17:78359396-78359418 GCACTGCAAGGGCGCAGCGTGGG 0: 1
1: 0
2: 1
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152111368 Original CRISPR GCTGCCCGGGGCCACCCTGC CGG (reversed) Intronic
900091156 1:921249-921271 GCTGCTCCGGGTCCCCCTGCTGG - Intergenic
900095950 1:940214-940236 TCTGCCTGGGGCCGCTCTGCTGG + Intronic
900117441 1:1034591-1034613 GCCGCCTGGCGCCTCCCTGCTGG + Intronic
900147157 1:1163305-1163327 GCTGGCGAGGGCCCCCCTGCAGG - Intergenic
900189023 1:1345537-1345559 GCTGCCAGGGGCGCCCCTGCCGG + Intronic
900349394 1:2227648-2227670 GGCGCCCGGGGCCCCCCTTCCGG - Intergenic
900564470 1:3325513-3325535 GCCGCCCAGGGCACCCCTGCTGG - Intronic
900612887 1:3551821-3551843 CCTGCCCGAGGCCACCCTCTGGG + Intronic
900626610 1:3611459-3611481 GATCGCCGGGTCCACCCTGCAGG + Exonic
900998026 1:6133377-6133399 GCAGCCCCAGGTCACCCTGCTGG - Intronic
901434048 1:9235227-9235249 GCCGCTCGGGGCGACCCTGGAGG - Intronic
901758564 1:11456091-11456113 GCTGGCCAGGGCCTCTCTGCTGG + Intergenic
901769692 1:11524033-11524055 CCGGCCTGAGGCCACCCTGCAGG + Exonic
901791551 1:11655859-11655881 GCTGCCCGAGAACATCCTGCTGG + Exonic
901793784 1:11668703-11668725 GCTGCCCGAGAACATCCTGCTGG + Exonic
902242841 1:15100248-15100270 GCATCCCGTGACCACCCTGCTGG - Intronic
902581284 1:17409397-17409419 GCTGCCCTGGGAGACCCAGCTGG + Intronic
902666271 1:17940997-17941019 ACTTCCTGGGGCTACCCTGCAGG - Intergenic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
903220829 1:21868890-21868912 GCTGCCCCGGGCCTTCCTGGGGG - Intronic
903227408 1:21901711-21901733 GCTGCCCAGGGCCAGGCTCCAGG + Intronic
903930311 1:26858149-26858171 GCTGCCCAAGGTCACCCAGCTGG + Intergenic
904027832 1:27515850-27515872 GCTGCCCTTGGCCACCCCTCAGG + Intergenic
904492132 1:30867790-30867812 GGTGCCCGGGGCCTCACTGTGGG - Intergenic
904541468 1:31236670-31236692 GCTGCCCAAAGCCACCCAGCCGG + Intronic
904607083 1:31703990-31704012 GCTGCCCGGCGCACGCCTGCCGG + Exonic
904664337 1:32108369-32108391 CCTGCCCGAGGCCACCATGTGGG - Intronic
905312135 1:37056624-37056646 GCTGTCTGGGCCCACCCAGCAGG - Intergenic
905693620 1:39959983-39960005 TCTGCCAGGAGCCACCCTGAAGG - Intronic
905874673 1:41424195-41424217 GCAGCCCAGGGGCGCCCTGCTGG + Intergenic
905919547 1:41710352-41710374 GCTGCCCTGGGTCACACAGCAGG - Intronic
906172145 1:43735482-43735504 TCTGCCAGGGGCCAGCCTTCAGG - Intronic
907268089 1:53274932-53274954 TCTGTCCTGGGCCACCCTCCAGG - Intronic
907766784 1:57421048-57421070 GATGCTTGGAGCCACCCTGCAGG - Intronic
910678954 1:89843418-89843440 TCGGCCCGGGCCCCCCCTGCTGG - Intronic
911041839 1:93597496-93597518 CCTGCCCGAGGCCACACAGCAGG - Intronic
912576166 1:110674623-110674645 GGTGCCCGGGGACCACCTGCTGG - Exonic
912703562 1:111895799-111895821 TCTTCCCGGGGCCAGCCGGCTGG + Intronic
913267664 1:117060589-117060611 GCTGCCCGGGGCCTCCCGAGAGG + Intronic
913500662 1:119469900-119469922 GCTGCCCTGGGCTACACAGCTGG + Intergenic
915526242 1:156478047-156478069 CCTGCCCAGGGCCACACAGCTGG + Intronic
915559226 1:156676764-156676786 GCTGCCCCGCGCCGCCCCGCGGG - Exonic
915903822 1:159863859-159863881 GCTGCCAGGGCCCACCCCTCTGG + Intronic
915904465 1:159867737-159867759 CAGGCCTGGGGCCACCCTGCAGG - Intronic
917974943 1:180232530-180232552 GCCTCCCTGGGCCACCCTGGGGG - Intronic
920363612 1:205436315-205436337 GCTGCCCAGGGCATCCCTGGAGG - Intronic
920380153 1:205530451-205530473 GGTGCCCGGGGCTGCTCTGCTGG - Intronic
923119756 1:230978974-230978996 CCAGCCCGGGGCCGCCTTGCCGG + Intronic
924600369 1:245483358-245483380 GCTGTCCGAGGTCACCCAGCTGG + Intronic
1062920531 10:1275401-1275423 GCTGCCTGGAGCCGCCCTGCAGG - Intronic
1063368927 10:5508360-5508382 GCTGCCCTGGGCCTGGCTGCAGG - Intergenic
1064430708 10:15267768-15267790 GCTCCTCATGGCCACCCTGCTGG - Intronic
1066013693 10:31217255-31217277 GCGGCCCGTGAGCACCCTGCAGG - Intergenic
1067295133 10:44971332-44971354 GCTGCTGCGGGCCACCCTGAGGG - Intronic
1067429540 10:46234078-46234100 GGTGCCCGAGGCCTCCCTCCAGG - Intergenic
1067800995 10:49359698-49359720 GCTGCCAGAGGCCAGACTGCGGG - Intergenic
1068845159 10:61663225-61663247 GCAGCCCGGCGCCCCCCAGCCGG + Intronic
1069617939 10:69818095-69818117 GCTGCCCATGCCTACCCTGCTGG + Intronic
1069841134 10:71340106-71340128 CCTGCCCAGGGCCCTCCTGCTGG + Intronic
1069980462 10:72248833-72248855 GCTGCCCCACCCCACCCTGCTGG - Intergenic
1070152076 10:73811365-73811387 GCCGCCCGGGACGACCCTGCGGG + Intronic
1072026782 10:91467597-91467619 GCTGGTGGGGGCCACTCTGCTGG - Intronic
1074130380 10:110568148-110568170 GCTGGCGGGGGGCACCCCGCCGG + Intronic
1074814519 10:117134367-117134389 GCTGCGCGGGCCCAGCTTGCCGG - Exonic
1074864796 10:117538443-117538465 GAAGCCCGGGGGCACCTTGCAGG + Intergenic
1076293713 10:129367788-129367810 GCCTGCCGGGACCACCCTGCAGG + Intergenic
1076494081 10:130885476-130885498 GCTGCCCAGAGCCACCCTCCAGG + Intergenic
1076669994 10:132115203-132115225 GCGGCTAGGGGTCACCCTGCCGG + Intronic
1076992091 11:280682-280704 GCTGCCCACGGCCCTCCTGCTGG + Exonic
1076996487 11:299672-299694 GCTGCCTTGGACCACCCAGCAGG + Intergenic
1077018324 11:406685-406707 GCTGCCTGGGGCCCCGATGCGGG - Intronic
1077095169 11:796053-796075 GTTGCCCAGGGCCACGCGGCTGG + Exonic
1077145027 11:1040866-1040888 GCTGCTGGGGTCCACCCTGCCGG + Intergenic
1077176292 11:1192504-1192526 GCTGACCGGCTCTACCCTGCAGG + Intronic
1077177136 11:1196120-1196142 ACTGCCCGAGCCCACCCTGTTGG - Intronic
1077298390 11:1836439-1836461 GCTGCCAGGGGCCACCCTGCAGG + Exonic
1077328507 11:1973868-1973890 GCTGCCCCCCACCACCCTGCAGG - Intronic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1077504067 11:2922155-2922177 GCTGCTCCGGGCCAGCGTGCTGG + Exonic
1077536913 11:3128945-3128967 GCCGCCCGGGGTCACCCCACCGG + Intronic
1077907583 11:6546126-6546148 GCAGCCAGGCACCACCCTGCAGG - Exonic
1079249178 11:18774610-18774632 GCTGGCTTTGGCCACCCTGCTGG + Intronic
1079389876 11:20012885-20012907 GATGCCCAAGGCCACACTGCTGG - Intronic
1081623862 11:44635052-44635074 CTTGTCCAGGGCCACCCTGCTGG - Intergenic
1081664631 11:44909704-44909726 GCTGGGCGGGGCCTGCCTGCTGG + Exonic
1082987710 11:59182378-59182400 GGTGGCCAGGGCCACCCTTCCGG - Exonic
1083609661 11:63998901-63998923 CCTGCCCCGGTCCACCCTGGGGG - Intronic
1083779780 11:64911841-64911863 TCTGCCCAGGCCCACCCAGCTGG - Exonic
1083895206 11:65616277-65616299 GCTGCCCGCGCCCCCCCTCCCGG - Exonic
1083901681 11:65646449-65646471 GCGGCTCACGGCCACCCTGCGGG - Exonic
1084191748 11:67502547-67502569 GCTGCCCAAGGCTGCCCTGCAGG - Exonic
1084269217 11:68020142-68020164 CCTGCCCAGGGTCACCCTGCTGG + Intronic
1084322896 11:68383572-68383594 CCTGCCCGAGGTCACCCAGCAGG + Intronic
1084486892 11:69453439-69453461 GCTGCCCCGGGAGACCCTGCAGG + Intergenic
1084960544 11:72714015-72714037 CCTGCCCGGGGCCACACAGTGGG + Intronic
1087316997 11:96614828-96614850 ACTGGGCAGGGCCACCCTGCAGG - Intergenic
1088878761 11:113957472-113957494 GCTGCCCTGGGCCAGCCTCCGGG + Intergenic
1088972993 11:114789903-114789925 TCTGCCCGGAGCCACCTGGCAGG + Intergenic
1089257477 11:117201476-117201498 GCTGCCCGGAGCCAGGCTCCTGG - Intronic
1089499902 11:118925769-118925791 GCCGCCCGGAGCCAGCCGGCCGG - Intronic
1090387632 11:126365924-126365946 GCTGCCCTGGGACACTCTCCAGG + Intronic
1090390197 11:126383122-126383144 GCTGCCCTGGGACACTCTCCAGG + Intronic
1091025201 11:132135615-132135637 ACTGCTAGGGGCCACCCTGGGGG + Intronic
1202811485 11_KI270721v1_random:29047-29069 GCTGCCCCCCACCACCCTGCAGG - Intergenic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1091616391 12:2053704-2053726 GCGGCCCCGGGCCACTCCGCAGG - Intronic
1091682491 12:2537066-2537088 CCTGCCCAGGGCCTCCCTGCCGG - Intronic
1092628579 12:10354672-10354694 AATGGCCGGGGCCTCCCTGCAGG - Intergenic
1096024700 12:48350804-48350826 GCGGCCCGGTGCCTCCCTCCCGG + Intronic
1102527146 12:113520173-113520195 GCTCCCCGGCGACACCCTTCTGG - Intergenic
1103590717 12:121990302-121990324 GCAGCCCCGGGGCACCCTTCAGG + Intronic
1104555879 12:129799602-129799624 GCTGCCCTGGGTCACCCAGTTGG + Intronic
1104953734 12:132453917-132453939 GGTGCCCGGGCTCAGCCTGCAGG + Intergenic
1105277897 13:18946927-18946949 GCTGTCCATGGCCAACCTGCAGG - Intergenic
1105512470 13:21061719-21061741 CCTGCCCACGGCCTCCCTGCTGG + Intergenic
1106555309 13:30803908-30803930 GCTGCCCAGGGCCATGCAGCAGG + Intergenic
1107437056 13:40389452-40389474 GCTGCCGGCTGCCTCCCTGCAGG - Intergenic
1108582417 13:51838643-51838665 GCTGACTGAGACCACCCTGCAGG - Intergenic
1108701445 13:52947753-52947775 GCTGCCGGGTTACACCCTGCAGG - Intergenic
1112807679 13:103180984-103181006 GCTGCCCAGGGGCACGCTCCCGG + Intergenic
1113674639 13:112198821-112198843 GCTGACAGGAGCCATCCTGCTGG - Intergenic
1113908878 13:113832532-113832554 GATGCCCGGCCCCTCCCTGCTGG + Intronic
1113947228 13:114051128-114051150 GCTGCCTGGGGCCAAGCTGGGGG + Intronic
1115645679 14:35367204-35367226 ACATCCCAGGGCCACCCTGCAGG + Intergenic
1115742173 14:36399832-36399854 GCAGCCCTGGGGCACCATGCTGG + Intergenic
1117339719 14:54782936-54782958 GCATCCCGGGGTCCCCCTGCAGG - Intronic
1117805240 14:59484172-59484194 GGTGTCTGGGCCCACCCTGCTGG - Exonic
1119777895 14:77259594-77259616 GCTCCTCGGGGCTGCCCTGCTGG - Intergenic
1120723903 14:87916686-87916708 GGTCCCAGGGGCCGCCCTGCTGG + Intronic
1120799128 14:88669521-88669543 ACTGTGCGGGGCCTCCCTGCAGG + Intronic
1120905882 14:89620943-89620965 GCTGCCCAGGGCAACCTGGCCGG + Intergenic
1121535722 14:94689618-94689640 GCTGGCCGGGGCCTCCGCGCTGG + Intergenic
1121639437 14:95475361-95475383 GCTGCACGGGTCCCCCCTGCAGG + Intronic
1122071427 14:99207908-99207930 CTTGCCCAGGGCCACCCAGCTGG - Intronic
1122143451 14:99675637-99675659 GCTGCCCCAGGCCATCCCGCCGG + Exonic
1122235433 14:100328587-100328609 CCAGCCCTGGGCCAGCCTGCAGG + Intronic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1122347144 14:101067602-101067624 GCTGCCCAGGGCACCTCTGCAGG + Intergenic
1122539965 14:102492650-102492672 GCTGCCTGGGAGCTCCCTGCAGG - Intronic
1122809099 14:104279211-104279233 CCTGCCTGGGGCCTGCCTGCTGG - Intergenic
1122898970 14:104774274-104774296 GCTGCCGGGGCCCAGCCTGATGG - Intronic
1123019930 14:105392931-105392953 GCTGCCCGAGGCCAGCCCGGGGG - Intronic
1123035354 14:105469696-105469718 GCTGCCCTGGGCCAGGCTGGGGG + Intronic
1123989246 15:25671215-25671237 GCTCCCCTGGGGCACCCGGCCGG - Intergenic
1124368514 15:29090446-29090468 ACTGACCAGGGCCACCCTGGGGG + Intronic
1125578587 15:40770705-40770727 GCAGCCCCGGGCCACCCTGCTGG + Exonic
1125720316 15:41842186-41842208 GCTCCTCGGGGGCATCCTGCAGG - Exonic
1125722913 15:41853661-41853683 GGAGGCCTGGGCCACCCTGCAGG - Exonic
1128114108 15:65094695-65094717 GCTCTCTGGGGCCACGCTGCAGG - Intronic
1128341552 15:66825905-66825927 CCTGCCGGGGCCCACCTTGCAGG + Intergenic
1128594411 15:68930742-68930764 GCGGACCGGGGACACCCTGGGGG + Intronic
1128719762 15:69939811-69939833 GATCCCAGGGGCCATCCTGCAGG - Intergenic
1128767861 15:70261999-70262021 GCTTCCCGGTGCCACCAGGCTGG + Intergenic
1128866814 15:71120523-71120545 GGTGCCCAGTGCCACCCTCCTGG - Intronic
1129117500 15:73373248-73373270 GCTTCCCTGGGCCACACTGGAGG - Intergenic
1129118031 15:73376146-73376168 TGTGCCCCAGGCCACCCTGCAGG + Intergenic
1129158271 15:73732403-73732425 ACTGCCCGGGGCCGGCCGGCCGG + Intergenic
1129466716 15:75728255-75728277 GCTACCCGGGGCCACATTGTGGG + Intergenic
1132393130 15:101453340-101453362 GCTGCACAGGGGCAGCCTGCGGG - Intronic
1132518117 16:375303-375325 GCTGGCCGGGGCCACGCTGACGG + Intronic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1132608321 16:802699-802721 GCAGGCCGGGTCCACCATGCAGG - Intergenic
1132612062 16:822121-822143 GCTGCCGGGGACCCTCCTGCAGG - Intergenic
1132690258 16:1178885-1178907 AGGGCGCGGGGCCACCCTGCTGG - Intronic
1132690277 16:1178942-1178964 GGGGCACGGGGCCAGCCTGCTGG - Intronic
1132855065 16:2041055-2041077 GCTGGCCGGGGCCACCGGGTGGG - Intronic
1132904604 16:2276123-2276145 GCAGCCCGGGGGCATCCTGGAGG - Exonic
1134090142 16:11387159-11387181 GCTGTCTGGGGCCAACGTGCTGG - Exonic
1135539881 16:23321575-23321597 GCTGCCCAAGGTCACTCTGCTGG - Intronic
1135991784 16:27222973-27222995 GCTGCCCCGGCCCCTCCTGCAGG + Intergenic
1137057874 16:35754035-35754057 GCGGCCCGGGGCCTTCCTGTGGG + Intergenic
1138530096 16:57630183-57630205 GCTGCCCGGGGCTATCCTCTGGG - Intronic
1139422787 16:66859288-66859310 TCTGCCCCAGGCCACCCTGAAGG + Intronic
1139426155 16:66881012-66881034 GTCGCCCGGGGGCACCCAGCTGG + Intronic
1141421837 16:83922550-83922572 CTTGCCCTGGGCCACCCAGCTGG - Exonic
1141531644 16:84650098-84650120 GCTGCCCGGCGTCACACAGCTGG - Intronic
1141633878 16:85303626-85303648 GCTGCCCGAGGCCGCACAGCTGG + Intergenic
1141823507 16:86463668-86463690 GCTGCCTGGAGCCACTCTGTGGG - Intergenic
1141924175 16:87156417-87156439 CCTGCCCGAGGTCACCCAGCTGG - Intronic
1142015960 16:87747616-87747638 CCTGCCCTGGGCCCACCTGCTGG - Intronic
1142124690 16:88404346-88404368 GCCGCCCAGGGCCAGTCTGCCGG - Intergenic
1142131350 16:88432958-88432980 GCTGCCCAGGGACATTCTGCAGG + Exonic
1142172050 16:88628041-88628063 GCTGCCCGGGGGGTGCCTGCTGG - Exonic
1142250641 16:88990253-88990275 GCTGCACTGGGCCACCCCCCAGG - Intergenic
1142302285 16:89265703-89265725 GCTGCCCGGGGCCACCCATGTGG - Intergenic
1142836745 17:2593457-2593479 GCTGAGCGGTGCCACCCGGCCGG - Intronic
1143480469 17:7224989-7225011 GCTGCCAGGGGTCAGACTGCAGG - Exonic
1143576107 17:7794269-7794291 GCTGCCATGGGCCCCCCTGGGGG + Exonic
1143894208 17:10123875-10123897 TCTGTCCGGGGCCCCCCTCCAGG - Intronic
1146332260 17:31937193-31937215 GCTCTCCGGGGCCGCCCGGCGGG + Exonic
1146993256 17:37295197-37295219 TCTGGCCGGGGCCACTCTGAAGG - Intronic
1147188280 17:38724706-38724728 GCTGCCCATGGCCAGCCTGCTGG + Exonic
1147743741 17:42682946-42682968 GCGGTTCGGGGCCGCCCTGCAGG - Intronic
1147962860 17:44178309-44178331 GCAGCCGGGTGGCACCCTGCCGG - Exonic
1147964834 17:44189015-44189037 GCTGGCAGGGTCCACGCTGCAGG - Exonic
1148143661 17:45346009-45346031 GCTTCCTGGGCCCACCCTTCAGG - Intergenic
1148462875 17:47848204-47848226 GCTGCCAGGGGCCTCCTCGCGGG - Exonic
1148564516 17:48625316-48625338 GCTGCCCGGGGCCGTGCGGCTGG - Intronic
1148779126 17:50111828-50111850 GCTTCCCTGGGCCACACTGAGGG - Exonic
1148788694 17:50160890-50160912 GCTGCCCAGGGCCAGCCCACAGG - Intergenic
1150124680 17:62628275-62628297 GCTCCCCGGGCGCGCCCTGCAGG - Intronic
1150196497 17:63304798-63304820 ATTGCACGGGGCCTCCCTGCAGG - Intronic
1150221544 17:63498203-63498225 GCTGCCAGCAGCCACCCTGCTGG + Intronic
1151210552 17:72540843-72540865 GCTGCTCTGGGGCATCCTGCAGG + Intergenic
1151880497 17:76891851-76891873 GCAGCACGGGGCCAGCCTGGTGG + Intronic
1152076740 17:78164562-78164584 GGTGCCCTGGGCAACCCTCCTGG - Intronic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152207245 17:78980759-78980781 GGGGCCCCGGGCCACACTGCTGG + Intergenic
1152225977 17:79092994-79093016 GATGCCCCGTGCCACCCTGCTGG - Intronic
1152335906 17:79700202-79700224 CCTGCCCAGGGCCCCCCAGCAGG + Intergenic
1152353965 17:79797863-79797885 CCTGCCCTCGGCCACCCTCCGGG + Intronic
1152600741 17:81260920-81260942 GCTGCACGGGGCCAGCCTTGCGG - Intronic
1152682695 17:81677297-81677319 GGTGCCTGTGGCCACCCGGCTGG - Intergenic
1152699644 17:81812609-81812631 GCTGCTCGTGGCCAAGCTGCGGG + Exonic
1152737399 17:82004257-82004279 GATGCCGGGGGCAGCCCTGCGGG - Intronic
1152791615 17:82283242-82283264 GCGGCCCTGGCCCAGCCTGCAGG + Intergenic
1152942508 17:83180363-83180385 GCTGCCTGGTGTGACCCTGCTGG + Intergenic
1155927509 18:31672813-31672835 GCTTGCTGGGGCCACACTGCTGG - Intronic
1157300285 18:46474277-46474299 ATTGCTGGGGGCCACCCTGCTGG + Intergenic
1157464510 18:47931505-47931527 GCTGCGCGGGGCCTCCCCGTGGG - Intergenic
1157735442 18:50044636-50044658 GGGGCTCGGGGCTACCCTGCTGG - Intronic
1158648883 18:59269355-59269377 GCTGCCCGGGCCCGCCCCGAGGG + Exonic
1160123167 18:76148112-76148134 GCTCTCCTGGGCCACCCTGTGGG - Intergenic
1160378227 18:78429843-78429865 GCGACCCGGGGCCACCGGGCAGG + Intergenic
1160575125 18:79848845-79848867 CCTGCCCGGGGCCACTCCTCAGG - Intergenic
1160586683 18:79917174-79917196 GCTGGCCGAGGCGGCCCTGCAGG - Intronic
1160723931 19:609247-609269 GCTGCCGGGGGGCACCGTCCTGG + Intronic
1160735581 19:660925-660947 CCTGCCCGTGTCCACCCCGCGGG - Intronic
1160774413 19:848428-848450 CCTGCCCAGGGCCACCCTGATGG - Intergenic
1160775582 19:853608-853630 GCAGATCGGGGCCTCCCTGCAGG - Intronic
1160779741 19:872490-872512 GCTGCCAGGGGCCACCCCTGGGG - Intronic
1160833470 19:1113796-1113818 GGGGCCCGGGGCAACCCTGAGGG + Intronic
1160978941 19:1807594-1807616 GCTTCCCCAGGTCACCCTGCAGG + Intronic
1161487732 19:4544561-4544583 GATGCCCAGGGCCACCCCGCCGG - Intronic
1163019304 19:14474077-14474099 GCTGTTCGTGGCCAGCCTGCTGG - Exonic
1163133669 19:15293320-15293342 CTTACCCGGTGCCACCCTGCTGG - Intronic
1163415608 19:17184745-17184767 GCTGCCCGGGCACTCGCTGCGGG + Intronic
1163523681 19:17807551-17807573 GGTGCCCTGGCCCTCCCTGCTGG - Intronic
1163534326 19:17868547-17868569 GATGTCCAGGGCCACCCAGCAGG + Intergenic
1163635222 19:18434254-18434276 GCAGCCCCGGGCCTCTCTGCGGG + Exonic
1163664547 19:18597105-18597127 AGTGCCCTGGGCCACACTGCTGG - Intronic
1163681236 19:18683837-18683859 GCTGCCCGCGCCGACCCTTCAGG + Intronic
1163718974 19:18889293-18889315 TTTGCCCAGGGCCACCCTGCTGG + Intronic
1164466681 19:28492930-28492952 GCTGCCCGGGACCAACCTGAGGG - Intergenic
1164630970 19:29761211-29761233 CCTGCCTGGGGCCACACAGCAGG - Intergenic
1165036379 19:33036741-33036763 ACTGCCCGGGGCCAGCGGGCCGG - Intronic
1165089292 19:33374160-33374182 GCTGCCCGGGGCGCCCCTCGCGG + Intronic
1165121624 19:33562734-33562756 GCTGCCTGTGGCCACTCAGCAGG + Intergenic
1165888929 19:39099093-39099115 GCTGCGCAGGGACACCCAGCAGG + Exonic
1166049489 19:40249474-40249496 CCAGCCCTGGGCCATCCTGCGGG + Intronic
1166052468 19:40268453-40268475 CCTGCCCAAGGCCACCCAGCTGG - Intronic
1166828080 19:45621637-45621659 CCTGCCCCTGGCCACCCTGCAGG - Exonic
1167470395 19:49672518-49672540 GCTGCCTGGGGACAGACTGCTGG + Intronic
1168327291 19:55544884-55544906 CCTCACCGGGGTCACCCTGCTGG + Exonic
926712370 2:15891614-15891636 TCTGTCCAGGGCCACCCTGCAGG - Intergenic
927722039 2:25389396-25389418 GCTGTCCGGGGCCACCCCGCGGG + Intronic
928410725 2:31052074-31052096 GCTCCACGGGACCATCCTGCTGG + Intronic
929188585 2:39120416-39120438 GCGCCCCGGGGGCACCATGCAGG - Exonic
929943483 2:46352753-46352775 GGTCCCTGGGGCCAACCTGCTGG + Intronic
930614048 2:53574818-53574840 GCTTCCCTGGGCCACACTGGAGG + Intronic
934648581 2:96073475-96073497 GTGGCCCGGGGCCACTCTGTGGG - Intergenic
936451693 2:112638549-112638571 CCTGCCAGGGCCCACCGTGCAGG + Intergenic
937271450 2:120655364-120655386 GCTGCATGGTGCCACCCTGGTGG - Intergenic
937301274 2:120843988-120844010 CCTGCCGGGGACCACACTGCAGG - Intronic
941808602 2:169734107-169734129 GCAGCCCGAGGCCGGCCTGCTGG + Intronic
946245543 2:218385158-218385180 GCTGCTCTGGGCCACCGTGTTGG + Exonic
947577605 2:231288731-231288753 TCTGCCCAGGGCCACACGGCCGG + Intronic
948461152 2:238130597-238130619 GCTGGCCGAGGCCTCCCTGCAGG - Exonic
948640761 2:239374861-239374883 GCTGCACAGGCCCACCCTGGCGG + Intronic
948674720 2:239590112-239590134 CCTGCCCGAGGCCACCCAGGAGG + Intergenic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
949035641 2:241814664-241814686 GCTGGCCGGGGGCTCCGTGCGGG + Exonic
1169198012 20:3693660-3693682 GTGGCCCGGGGCTACCGTGCGGG - Exonic
1169217158 20:3800584-3800606 CCTGCCTGGGGACACCCAGCTGG - Intronic
1169235210 20:3925035-3925057 GCTGCCCAGGGTCACTCAGCTGG + Intronic
1171202858 20:23255921-23255943 GTGGCCTGGGGCCACCCTGCAGG + Intergenic
1171459510 20:25290943-25290965 TCTGCCCTGGGCCCCTCTGCTGG + Intronic
1171459540 20:25291036-25291058 TCTGCCCTGGGCCCCTCTGCTGG + Intronic
1172054042 20:32141778-32141800 CCTGCCTGTGGCCACCCGGCTGG + Exonic
1172872639 20:38145189-38145211 GCTGCCCTGACCCAGCCTGCTGG + Intronic
1172967812 20:38851010-38851032 GCTGCCTGGGGCCACACCCCCGG + Intronic
1173909247 20:46651681-46651703 GCTGCCCCAGGCCACATTGCTGG - Intronic
1175129132 20:56775997-56776019 GCTGCCCTGTGTCACCCTGGGGG - Intergenic
1175854512 20:62113322-62113344 GGAGCCCTGGGACACCCTGCTGG + Intergenic
1175865285 20:62172767-62172789 GCTGCCCGGGGTAGCTCTGCTGG - Exonic
1175993412 20:62801235-62801257 GCTGCCTGGGGGGACCCTGTGGG + Exonic
1176039190 20:63055642-63055664 GCTGCCAGGGACTCCCCTGCAGG - Intergenic
1176231536 20:64035707-64035729 GCTTCCCGGGCCCCCGCTGCTGG - Intronic
1176313171 21:5165432-5165454 GGGGGCCAGGGCCACCCTGCAGG + Intergenic
1176386754 21:6141808-6141830 GCTGCTCAGGGCCAGCCAGCGGG + Intergenic
1179736719 21:43396444-43396466 GCTGCTCAGGGCCAGCCAGCGGG - Intergenic
1179843877 21:44096598-44096620 GGGGGCCAGGGCCACCCTGCAGG - Intronic
1180557805 22:16591908-16591930 GCTGCCCGGGGGGACACTGGAGG - Exonic
1180874175 22:19167104-19167126 GCTCCTCGTTGCCACCCTGCCGG + Intergenic
1180948029 22:19707567-19707589 CCTGCCCAGGGCCCCTCTGCTGG + Intergenic
1180954503 22:19735634-19735656 CATGCCTGGGGCCACTCTGCAGG - Intergenic
1180998818 22:19978464-19978486 GCTGCGCGGGAACACCCTGATGG + Intronic
1181041708 22:20195445-20195467 GCTTCCCTGGGCCCCACTGCAGG + Intergenic
1181283923 22:21738933-21738955 GCTGCCCAAGGCCACCCAGAAGG - Intergenic
1181370364 22:22410336-22410358 GCTGCCGGGGCTCACCCTCCTGG - Intergenic
1181473238 22:23153471-23153493 CCTGCGGGAGGCCACCCTGCTGG - Intronic
1181493470 22:23275059-23275081 CCTGCCCTGGGCCACCAGGCAGG + Intronic
1182349818 22:29692941-29692963 CCTGCCCAGGGCCACACAGCTGG + Intronic
1182418174 22:30234858-30234880 GCTGCCCAGGGCCCTCATGCAGG - Intergenic
1182464480 22:30505835-30505857 GCTGCCCCAGGCCACTCTCCCGG - Intergenic
1183578247 22:38706140-38706162 GCCGCCCGGGCCTACCTTGCTGG - Exonic
1183647040 22:39132934-39132956 GCTGCACCGGGCCAGGCTGCGGG - Exonic
1183736008 22:39645375-39645397 GCTGCCCTGGGCGACCCGGGTGG - Intronic
1184151764 22:42643651-42643673 CATGCCCAGGGCCACCCAGCTGG + Intronic
1184153003 22:42649309-42649331 GCGGCGCGGGGCCACCATGGGGG - Intronic
1184337133 22:43860540-43860562 TCTGCCCAGGGTCACTCTGCTGG + Intronic
1184370180 22:44077025-44077047 CCTGCCCGGGGCCAAGCAGCAGG + Intronic
1184784288 22:46664328-46664350 GTGGCCCGGGGCTAGCCTGCAGG + Intronic
1184987031 22:48142715-48142737 GCTGCCTGGGACGTCCCTGCTGG + Intergenic
1185010202 22:48308713-48308735 GCTGCCCAGAGTCACCCAGCGGG + Intergenic
1185047246 22:48534646-48534668 GCTTGCTGGGGCCGCCCTGCGGG + Intronic
949522446 3:4869077-4869099 GGTGTCCAAGGCCACCCTGCTGG + Intronic
949526545 3:4910325-4910347 GCTGATCGGGGCCACCCCTCAGG + Intergenic
950264144 3:11562242-11562264 GCTGCCCAAGGCCACCCTCTTGG + Intronic
950454714 3:13085831-13085853 GCTGCCCAGGCCCTTCCTGCGGG + Intergenic
950708986 3:14801881-14801903 TCGGCCTGGGGCCCCCCTGCTGG + Intergenic
952634032 3:35505530-35505552 ACTGGGCGGGGCCTCCCTGCAGG + Intergenic
953137066 3:40190306-40190328 GCTGTCCGAGGTCTCCCTGCTGG - Exonic
954205696 3:49057392-49057414 GCAGCCGGTGGCCACCGTGCTGG - Exonic
954293779 3:49663093-49663115 GCCGCCCGTGGTCACCGTGCCGG - Exonic
960493425 3:118346525-118346547 GCTTCCCTGGGCCACATTGCAGG + Intergenic
960942314 3:122943060-122943082 GGTGCCCAGGGGCCCCCTGCCGG - Intronic
961652906 3:128426249-128426271 CCTGCCCAGGGCCACACAGCAGG - Intergenic
961726178 3:128932557-128932579 CCTGGCCTGGGCTACCCTGCTGG - Intronic
962281623 3:134056560-134056582 GCTGCCCCAGGCCGCCCTCCTGG - Intergenic
965166068 3:165195614-165195636 GCTGCGAGGGGCTACCCAGCAGG + Exonic
966875163 3:184317402-184317424 GCTGCCCATGTCTACCCTGCTGG + Exonic
968502677 4:958382-958404 CCTGGCCCTGGCCACCCTGCGGG + Exonic
968504658 4:966286-966308 GCAGCTCGAGGCCTCCCTGCAGG + Intronic
968504753 4:966654-966676 GATGTCCGGCACCACCCTGCAGG + Intronic
968615328 4:1575144-1575166 GCAGCTGGGGGCCACCCGGCAGG + Intergenic
968873647 4:3254088-3254110 GCTCCCCAGGCCCACCCCGCAGG - Intronic
968980988 4:3849213-3849235 GGTGGCCAAGGCCACCCTGCAGG - Intergenic
969178851 4:5421880-5421902 CCTGCCCAGGGCCACACAGCTGG + Intronic
969327623 4:6452944-6452966 GCTCCCCACGGCCACACTGCAGG + Intronic
969669262 4:8580747-8580769 GCAGCCCGGGGCCGCCCTGGAGG - Exonic
969688205 4:8688704-8688726 CTTGCCCGGCGCCACCCAGCTGG - Intergenic
969728520 4:8939787-8939809 GGTGCTTGGGGCCTCCCTGCTGG + Intergenic
973018694 4:45172687-45172709 ACTGGGCGGGGCCTCCCTGCAGG - Intergenic
978062432 4:104354418-104354440 TGGGCCCAGGGCCACCCTGCTGG + Intergenic
980794517 4:137663457-137663479 TCTGCCCAGGGCCCCTCTGCTGG + Intergenic
980971830 4:139574246-139574268 TCTGCCCAGGCTCACCCTGCTGG + Intronic
982663158 4:158229707-158229729 ACTGGGCGGGGCCTCCCTGCAGG - Intronic
983561508 4:169106387-169106409 GCTTCCCTGGGCCACACTGAAGG - Intronic
984811118 4:183797423-183797445 GCAGCTCCGGGCCACCCTTCGGG - Intergenic
985617453 5:932233-932255 CCTCCCAGGGGCCACACTGCAGG - Intergenic
985895571 5:2748627-2748649 GCTGCCCGCGGCCGCCGCGCCGG - Exonic
988717281 5:33840736-33840758 GATCCCCAGGGCCACCCTGCAGG + Intronic
989620531 5:43379675-43379697 GGTGTCCTGGGCCTCCCTGCTGG - Exonic
991574301 5:68086628-68086650 GCAACCCGGGGACACCCTGTTGG - Intergenic
992105788 5:73448209-73448231 GCTGCGCGGGGACAGCCAGCCGG + Exonic
994670209 5:102754975-102754997 GCTTCCCGGGGTTTCCCTGCGGG - Intronic
995650117 5:114361185-114361207 GCTTCCCGGGTCCCCCCTGGCGG - Intronic
995894690 5:116998299-116998321 GCTGTGAGGGGCCACCCCGCTGG - Intergenic
997401183 5:133603929-133603951 ACTGCTCGGAGCCTCCCTGCCGG - Exonic
997856280 5:137375840-137375862 GCTACCCCAGTCCACCCTGCTGG + Intronic
997939932 5:138148078-138148100 GCTTCCCTGGGCCACACTGGAGG + Intronic
998458810 5:142294402-142294424 GTAGCCCAAGGCCACCCTGCTGG + Intergenic
998643338 5:144036534-144036556 GCTGCCTGGGACCTGCCTGCTGG - Intergenic
999301949 5:150496691-150496713 ACTGCTCTGGGCCACCCTGAGGG - Intronic
999731204 5:154477833-154477855 GCTGCCCCGGACTTCCCTGCGGG - Exonic
1002158489 5:177301381-177301403 TCTTCCTGGGGCCACCCGGCTGG - Intronic
1002929646 6:1624423-1624445 GCAGCCCGGGGCCCCGCAGCGGG + Intronic
1003367162 6:5485772-5485794 GCGGCTCATGGCCACCCTGCAGG - Intronic
1003836216 6:10074923-10074945 ACTGCCCGGGGCTTGCCTGCCGG + Intronic
1004650121 6:17600428-17600450 GAAGCCCGAGGCCACCCTCCCGG + Exonic
1006513768 6:34534929-34534951 GCTGCACGGGCCCGCCCTGGTGG + Exonic
1006827659 6:36948080-36948102 CCTGCCCCAGGCCACCCAGCCGG + Intergenic
1007095036 6:39207823-39207845 CCTGCCCTGGGCCCCCTTGCCGG + Intronic
1007237082 6:40398337-40398359 GCTGCCAGGGGCAACCTTACAGG + Intronic
1007383198 6:41503825-41503847 GCTGCCCGCGGCCCTCCGGCGGG + Intergenic
1007398515 6:41590506-41590528 GCTGACAGGGCCCAGCCTGCAGG - Intronic
1007594780 6:43044780-43044802 GCTGACCAGGGCCTCCCAGCAGG + Exonic
1007619602 6:43203937-43203959 GCTGACCAGGGCCTCCCAGCAGG - Exonic
1010207110 6:73332787-73332809 GCTGGCCTGGGCCATCTTGCTGG - Intergenic
1011607258 6:89117704-89117726 GCTGCGCGGAGCCTCCCCGCGGG - Intronic
1017819811 6:158041175-158041197 TGTGCCCAGGGCCACCCTGCTGG + Intronic
1018488053 6:164262562-164262584 GCTGCCCAGGGCCTGCATGCGGG + Intergenic
1018856501 6:167678868-167678890 GCTGCCTGGGGCCGCGCTGTGGG - Intergenic
1018901449 6:168053836-168053858 GCTGCCCCGGGCCTCCCAGATGG + Intergenic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1019262561 7:89668-89690 GCTGCCCAGGGCCAGTCAGCAGG - Intergenic
1019310719 7:359395-359417 TCTGCCCGGGGCCACCCAGCAGG + Intergenic
1019329276 7:454703-454725 TCTGCCGGGGGCCACCGAGCCGG + Intergenic
1019526997 7:1484952-1484974 CCTCCCCAGGGCCACACTGCCGG + Intronic
1019527012 7:1484987-1485009 CCTCCCCAGGGCCACACTGCCGG + Intronic
1019527027 7:1485022-1485044 CCTCCCCAGGGCCACACTGCCGG + Intronic
1019527042 7:1485057-1485079 CCTCCCCAGGGCCACACTGCTGG + Intronic
1019554125 7:1620083-1620105 GCTGCCCGTGGCCGCCCCGTCGG - Intergenic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1019670973 7:2278165-2278187 GCTGGCCAGGGACACCGTGCAGG - Exonic
1020002678 7:4764706-4764728 GCTGCCTGTGGCCACCCTGATGG + Exonic
1022286483 7:28958942-28958964 TCTTCCAGGTGCCACCCTGCGGG + Intergenic
1022441110 7:30434139-30434161 GTTGCCCGAGGTCACCCTGCTGG - Intronic
1022467116 7:30659429-30659451 GCTGCCAAGGGCCATCCTGGAGG - Intronic
1023711077 7:42993212-42993234 GCGGACCGGGAGCACCCTGCCGG - Intergenic
1023785625 7:43705281-43705303 GCTTCCCCGTGCCACTCTGCAGG - Intronic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1024297491 7:47857094-47857116 GGAGCCAGGGGCCACCCTGCAGG + Intronic
1024569412 7:50711355-50711377 GCTCCCTGGGGCCTTCCTGCAGG + Intronic
1024589985 7:50872779-50872801 GCTGGGCGGGGCCTCCCTGCAGG + Intergenic
1025941010 7:66076157-66076179 CCTGCCTCGGGCCACCCTGCTGG + Intronic
1026850173 7:73719103-73719125 CCTGCGCGGGGCCCCGCTGCGGG - Intronic
1028088446 7:86667714-86667736 TCTGCCCAGGCCCACCCTCCAGG + Intronic
1029435929 7:100564069-100564091 GCTTCCCTGGTCCCCCCTGCTGG - Intronic
1030872613 7:114775512-114775534 CCTGCCTGGCACCACCCTGCTGG - Intergenic
1034541634 7:151762218-151762240 GCTGCCCTCGGCTACCATGCAGG - Intronic
1035203515 7:157280661-157280683 TCTGCACGGGGTCACCCTGCTGG + Intergenic
1035421851 7:158736141-158736163 CCTGCCCCAGGCCACCGTGCTGG + Intronic
1035566317 8:643543-643565 GCTGCCAGGGCCCAGCCGGCAGG - Intronic
1035567909 8:653954-653976 TCTGCTCAGTGCCACCCTGCGGG - Intronic
1035640791 8:1183583-1183605 GCTGCCCGGGGCCACAGAGGCGG + Intergenic
1035708613 8:1695893-1695915 GCTGGCCAGGGCCGCCCTCCTGG + Intronic
1035781842 8:2233774-2233796 TCTGCCTCGGGGCACCCTGCTGG - Intergenic
1035810276 8:2485632-2485654 CCTGCCTCGGGGCACCCTGCTGG + Intergenic
1035926391 8:3732224-3732246 TTCGCCCGAGGCCACCCTGCAGG + Intronic
1036637191 8:10559461-10559483 CTTGCCTGGGGCCACGCTGCAGG + Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1039880216 8:41621013-41621035 GCTGGCTGGGGCCACCGTGCGGG + Exonic
1039966327 8:42286869-42286891 GGTGCCCTGTGCCACCCTGCAGG + Intronic
1040310038 8:46232142-46232164 CCTGCCCGGGACAACCCTGGGGG - Intergenic
1040561415 8:48526046-48526068 ACTGCCCGGGGCCCACATGCAGG + Intergenic
1040841835 8:51792764-51792786 ACTGGGCGGGGCCTCCCTGCTGG + Intronic
1041244992 8:55880636-55880658 CCTGCCCGGGGCCACCAGGGAGG - Intronic
1044730601 8:95225837-95225859 GCTCCTTGGGGCCTCCCTGCAGG - Intergenic
1045320795 8:101080333-101080355 TCTGCCCTGGGCCACACTGGTGG - Intergenic
1045711565 8:104990539-104990561 GATGCCCGGGTTTACCCTGCTGG + Intronic
1047168518 8:122466820-122466842 GTTGCTGGGGGCCATCCTGCTGG - Intergenic
1047216675 8:122881697-122881719 CTTGCCCAAGGCCACCCTGCAGG + Intronic
1047777657 8:128086776-128086798 GCAGCCAGGGCCCACCCTGTAGG - Intergenic
1048444697 8:134484584-134484606 ACTACCCAGGGCCACACTGCTGG + Intronic
1048591791 8:135827131-135827153 TTTGCTCGGGGCCACCCAGCTGG - Intergenic
1049194102 8:141306179-141306201 GCTGCCCAGGGCCACCTCCCGGG - Intronic
1049229573 8:141475008-141475030 GTGGCCAGGGGCCACCCTTCTGG + Intergenic
1049397869 8:142409990-142410012 GATGCGCTGGGCCACCCAGCAGG - Intergenic
1049492218 8:142911487-142911509 GCTGCCTGGGGTCAGGCTGCAGG + Exonic
1049497273 8:142942140-142942162 GCTGCACCAGGCCACCCTGCTGG + Intergenic
1049557596 8:143290932-143290954 GCTGCCCCCCGCCTCCCTGCAGG - Intronic
1049624853 8:143615346-143615368 GCTTGCCGGGTCCACCCCGCGGG + Intronic
1049746402 8:144265074-144265096 GCAGCCGGGGGCCACCATGTCGG + Intronic
1050618290 9:7426277-7426299 ACTGGGCGGGGCCTCCCTGCAGG - Intergenic
1051449412 9:17178642-17178664 ACTGCCCGGGGCCTGCCGGCTGG + Intronic
1052340699 9:27361717-27361739 GCTGCCCAAGGTCACCCAGCGGG + Intronic
1053198318 9:36136601-36136623 GGCGCCCGGGGCCACCCCGTGGG - Intronic
1054464160 9:65483063-65483085 GCTTCCCCGTGCCGCCCTGCGGG - Intergenic
1056545011 9:87606207-87606229 GCTCCCAGGCGCCACCCTGCAGG + Intronic
1057025600 9:91732305-91732327 ACTGGCCATGGCCACCCTGCTGG + Intronic
1057182109 9:93035813-93035835 CCTGCTCTGGGCCACACTGCTGG - Exonic
1057275400 9:93673630-93673652 GCTGTCCATGGCCAACCTGCAGG + Exonic
1057463803 9:95292505-95292527 GCAGCCCGCGGCCTCCGTGCTGG + Intronic
1058153458 9:101486688-101486710 GCTGCCCTGGGGACCCCTGCGGG + Intronic
1058663079 9:107283614-107283636 GCTGCGCGGCGGCACCATGCAGG + Exonic
1060398245 9:123331503-123331525 GTTGCCCAGGGCCACACAGCTGG - Intergenic
1060700662 9:125747101-125747123 GTTGCGCGGGGCCGCCCGGCGGG + Intergenic
1060935104 9:127510058-127510080 GCTGCCCGGAGTCACGCAGCCGG + Intronic
1061325456 9:129861246-129861268 CCTGCCCAGGGTCACCCAGCTGG - Intronic
1061525907 9:131162076-131162098 GCTTCCCTGGGCCACACTGGAGG - Intronic
1062112492 9:134789794-134789816 GCTGGCCCAGGCCTCCCTGCAGG + Intronic
1062344905 9:136110091-136110113 TCTGCCCAGGCCCTCCCTGCAGG - Intergenic
1062427487 9:136512617-136512639 GCTCCCGGCGCCCACCCTGCTGG - Intronic
1062491070 9:136805164-136805186 GCTGCCTGGGGCGTCCCTGCAGG + Intronic
1062605758 9:137348238-137348260 GCTGACCAGGGCCTCACTGCAGG - Exonic
1203770820 EBV:49230-49252 GCTGCCCAAGCCCACCCTCCAGG + Intergenic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1187405265 X:18998130-18998152 GCTGCCCTGGGACACTCAGCGGG - Intronic
1190844910 X:54182841-54182863 GCTGCCCGGGGCCCGGGTGCTGG - Exonic
1192429213 X:71101272-71101294 GCTGACAGGGGCCCCTCTGCTGG - Exonic
1194183115 X:90737683-90737705 ACTGGGCGGGGCCTCCCTGCAGG + Intergenic
1195178598 X:102334382-102334404 GGTGCCAAGGGGCACCCTGCGGG - Intergenic
1195180266 X:102352701-102352723 GGTGCCAAGGGGCACCCTGCGGG + Intergenic
1198158638 X:133985833-133985855 GCTGCCGGGAGCCACCGCGCGGG - Intronic
1199855184 X:151753832-151753854 ACTACACGGTGCCACCCTGCAGG + Intergenic
1200133742 X:153864777-153864799 GCTGGCCGGGGCCTCCCTGTTGG + Intronic
1200140916 X:153902567-153902589 GCTGCCCAGGGCCTCTCTCCTGG + Intronic
1200277776 X:154750881-154750903 GCTCCCCGCGGCCGCCCCGCGGG + Intronic
1200292634 X:154886899-154886921 GCTGCCCCTGGCCGCGCTGCAGG + Exonic
1200339478 X:155382639-155382661 GCTGCCCCTGGCCGCGCTGCAGG + Exonic
1200346992 X:155458054-155458076 GCTGCCCCTGGCCGCGCTGCAGG - Exonic