ID: 1152114832

View in Genome Browser
Species Human (GRCh38)
Location 17:78378981-78379003
Sequence CCTTCTTGAGGGAGGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 538}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152114822_1152114832 2 Left 1152114822 17:78378956-78378978 CCTGACCTATGTGCTTCTTCACT 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538
1152114816_1152114832 29 Left 1152114816 17:78378929-78378951 CCCATTTCTGCCTCCCGGGGCTC 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538
1152114820_1152114832 16 Left 1152114820 17:78378942-78378964 CCCGGGGCTCGGCGCCTGACCTA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538
1152114817_1152114832 28 Left 1152114817 17:78378930-78378952 CCATTTCTGCCTCCCGGGGCTCG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538
1152114824_1152114832 -3 Left 1152114824 17:78378961-78378983 CCTATGTGCTTCTTCACTGGCCT 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538
1152114821_1152114832 15 Left 1152114821 17:78378943-78378965 CCGGGGCTCGGCGCCTGACCTAT 0: 1
1: 0
2: 1
3: 2
4: 70
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538
1152114819_1152114832 19 Left 1152114819 17:78378939-78378961 CCTCCCGGGGCTCGGCGCCTGAC 0: 1
1: 0
2: 0
3: 20
4: 125
Right 1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG 0: 1
1: 0
2: 4
3: 70
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152114832 Original CRISPR CCTTCTTGAGGGAGGGTGGG CGG Intronic
900090793 1:919609-919631 CCTACATGAGTGAGGGTGGAGGG - Intergenic
901235830 1:7667250-7667272 CCTTCATGGGGTGGGGTGGGGGG - Intronic
901414489 1:9107191-9107213 CCTTCTGGAGAGGAGGTGGGTGG - Intronic
902087060 1:13871416-13871438 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
902260027 1:15218009-15218031 CATTCCTAAAGGAGGGTGGGAGG + Intronic
902375309 1:16027568-16027590 CCTCCTTCAGGGAGGATGGAAGG + Intronic
902434478 1:16389260-16389282 TTTTTTTGAGGGGGGGTGGGGGG + Intronic
902614128 1:17614602-17614624 TCTTCTTGTTGGGGGGTGGGAGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903275150 1:22216878-22216900 CCTTCTTGCTGGAGGTTGGCGGG + Intergenic
904276924 1:29390913-29390935 ATTTCTGCAGGGAGGGTGGGTGG + Intergenic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905609979 1:39342050-39342072 CCTACTTGAGGGTGAGGGGGTGG - Intronic
905863370 1:41364414-41364436 CCTGCTGGCGGGGGGGTGGGGGG + Intronic
906091198 1:43181008-43181030 CCTTCCTGAAGGAGGGCAGGGGG - Intronic
906101579 1:43267338-43267360 CATTCCTGAAGGAGGGAGGGAGG + Intronic
906987784 1:50705129-50705151 CTATCTTCATGGAGGGTGGGGGG - Intronic
907303064 1:53500282-53500304 CCTCCTTGCGGGAGGGTCTGGGG - Intergenic
908855612 1:68423591-68423613 ACATGTTGAGGGAGGGTGGCTGG + Intergenic
909293044 1:73908900-73908922 CCTTTTTGGGGCAGGCTGGGGGG - Intergenic
909892560 1:81025904-81025926 ACTTCATGGGGGAGGGTAGGAGG - Intergenic
910365475 1:86460441-86460463 CATTCCTGGTGGAGGGTGGGGGG + Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
911348091 1:96721513-96721535 CCTCCTTGTGGGGGCGTGGGTGG - Intergenic
911636106 1:100238095-100238117 TCATCTTGAGGGAGGGAGGGAGG - Intronic
911812658 1:102303190-102303212 TTGTCTTGAGGGAGGGTGGGGGG + Intergenic
912392968 1:109317567-109317589 CCTTCCTGGGGGTGGTTGGGCGG + Intronic
912891200 1:113533429-113533451 CCTTCAGGGTGGAGGGTGGGAGG + Intronic
913352055 1:117872679-117872701 GCCTGTTGGGGGAGGGTGGGGGG + Intronic
915305645 1:154975918-154975940 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
915547515 1:156609752-156609774 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
915655128 1:157353031-157353053 CCTTCTTGGGGGATTGAGGGAGG - Intergenic
916345580 1:163787545-163787567 CCTGCTTAAGGCAGAGTGGGTGG + Intergenic
916575889 1:166066090-166066112 CCATGTTGAGGGACGGCGGGTGG + Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
918892577 1:190294955-190294977 TCTGCTTGAGGGAAAGTGGGAGG - Intronic
918981742 1:191570369-191570391 CCTACTTGAGGGTGGGAGGGTGG + Intergenic
920185427 1:204156395-204156417 CCTTCCTGAGTGTGGGTGGGTGG + Intronic
920618727 1:207522670-207522692 CTTTCTTGAGGGTGGATGGTTGG + Intronic
920870879 1:209793715-209793737 CCTTGAGGACGGAGGGTGGGAGG - Intronic
920907734 1:210187810-210187832 CCTTCTTAAGGGCGGAGGGGTGG - Intergenic
921083171 1:211760453-211760475 CTTTTTTGAGGGGGGTTGGGGGG - Intronic
922305933 1:224344484-224344506 CTTTTTTGAGGGTGGGTAGGGGG + Intergenic
924568336 1:245216393-245216415 ACTTCTTGAGGGTGGGGTGGGGG - Intronic
1063293745 10:4779874-4779896 CGTTCTTGAGGAAGCATGGGAGG + Intergenic
1063526842 10:6795100-6795122 GCTTGATGGGGGAGGGTGGGAGG + Intergenic
1063842996 10:10092658-10092680 CCTTTTTGAGGGAGGGTGTGTGG + Intergenic
1063960041 10:11299454-11299476 CCTTCCTGGGGGGGGTTGGGGGG - Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1064973184 10:21087023-21087045 TCTTGGTGAGGGAGGGTGGTAGG - Intronic
1065592310 10:27276916-27276938 CCTTAAGGATGGAGGGTGGGAGG + Intergenic
1066086958 10:31980477-31980499 ACTTGGGGAGGGAGGGTGGGAGG - Intergenic
1067131982 10:43573786-43573808 CCTGATGGAGGGAGTGTGGGTGG - Intronic
1070786540 10:79165417-79165439 GCTTCCAGAGGGAGGGAGGGAGG + Intronic
1071443469 10:85725022-85725044 CCTTCTTGGTGGAGGGTAGAGGG - Intronic
1072076439 10:91978976-91978998 CCTACTTGAGGGTGGGAAGGAGG - Intronic
1072305163 10:94100314-94100336 CCTGATTTAGGGAGGGTGAGGGG - Intronic
1073070180 10:100788367-100788389 CCTTCTGGAGGGGCAGTGGGAGG + Intronic
1073191192 10:101651606-101651628 CCTTATAGAGGGAGGGAAGGAGG - Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073982670 10:109172815-109172837 CCTTCATGTGGGCAGGTGGGGGG - Intergenic
1074089187 10:110231360-110231382 CTTTTTTGAGGGGGGGGGGGTGG - Intronic
1074214502 10:111370950-111370972 CCTACTTGAGGGTGGGTGGTAGG - Intergenic
1074794656 10:116930382-116930404 ACTTGATGATGGAGGGTGGGAGG - Intronic
1075614265 10:123880148-123880170 CCCTGTTCAGGGAGGGTGGGTGG - Intronic
1075764117 10:124879326-124879348 CCTTGAGGAGGGAGGGTGTGGGG - Intergenic
1076000371 10:126908118-126908140 CCCCCATCAGGGAGGGTGGGAGG + Intronic
1076097134 10:127740565-127740587 GCATTTTGGGGGAGGGTGGGAGG + Exonic
1076325455 10:129617122-129617144 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1076942906 10:133621775-133621797 CCTACTTGAGGGTGGGGGGTGGG + Intergenic
1077058224 11:606249-606271 CCTCCCAGAGGGAGGGAGGGAGG - Intronic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1079984566 11:27187168-27187190 CTTTCTGGAGTGAGTGTGGGTGG - Intergenic
1081669863 11:44936928-44936950 CCCGCTTGGGAGAGGGTGGGGGG + Intronic
1081781173 11:45714088-45714110 CCATCTTGAATGGGGGTGGGAGG - Intergenic
1081978911 11:47254148-47254170 CCATCTTGTGGGAGTGGGGGTGG - Intronic
1083022365 11:59520047-59520069 CCTACTTGAGGGGAGGAGGGTGG + Intergenic
1083629823 11:64089704-64089726 GGCTCTTGAGGGAGGGTGAGAGG + Intronic
1083742107 11:64716539-64716561 CCGTGTGGAGGGAGAGTGGGAGG + Intronic
1083890064 11:65591564-65591586 CCTTCTGGGGGGTGTGTGGGAGG + Intronic
1083898415 11:65631967-65631989 CCTTCTTGATGAAAGGGGGGTGG - Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1084346869 11:68558168-68558190 CCTTCTTTAGTGAGGGTGAAAGG + Intronic
1084438335 11:69156953-69156975 GCTTCTTGATGGAGGTTGGAGGG + Intergenic
1084645678 11:70456175-70456197 CCATCTTGTGGGAGGGGGGAGGG + Intergenic
1084743693 11:71154961-71154983 CCCTCTTCTGGGAGCGTGGGCGG - Intronic
1084743849 11:71155395-71155417 CCCTCTTCTGGGAGCGTGGGCGG - Intronic
1084861504 11:72021498-72021520 ACATCTTGAGGGGAGGTGGGAGG - Intronic
1084905953 11:72347686-72347708 ACATCTTGGGTGAGGGTGGGGGG - Intronic
1085108808 11:73869313-73869335 CTTTATGGAGAGAGGGTGGGAGG + Intergenic
1085255556 11:75170722-75170744 CCTTCCAGAAGGAGAGTGGGCGG - Intronic
1085918996 11:80928852-80928874 CCTTGTGGAGGGAAGGTAGGAGG - Intergenic
1086611917 11:88767667-88767689 CCTACTTGAGGGTGGATGGTAGG + Intronic
1087181179 11:95144081-95144103 TCTTCCTGAGGGAGGGAGGGGGG - Intergenic
1087842823 11:102937512-102937534 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
1087926267 11:103922428-103922450 CCTTCAGGATGGAGGGTGAGGGG - Intronic
1088250318 11:107856721-107856743 CCGTCAGGAGGGAGGGAGGGAGG + Intronic
1088259359 11:107929173-107929195 CCTGCTTGGAGGAGGGTGGTCGG - Intronic
1089179051 11:116568220-116568242 GGTTCTGGAGGGAGGGAGGGAGG + Intergenic
1089577268 11:119454016-119454038 CTTCCTTCAGGGAGGGTGGGTGG + Intergenic
1089795851 11:120980285-120980307 CCCTGTCGAGGGAGGCTGGGTGG - Intronic
1090083172 11:123627929-123627951 CCTTCTCACGGGAGGGAGGGAGG + Intergenic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1091787517 12:3252015-3252037 CCTGCGTGAGTGAGGGTGAGGGG + Intronic
1091798947 12:3312623-3312645 CCTTCGTGAGCTAGGGAGGGGGG + Intergenic
1091813458 12:3418782-3418804 TCCTCTGGAGGAAGGGTGGGTGG + Intronic
1092532003 12:9352628-9352650 CCTTCTTGGGGGAGGGGGAGAGG - Intergenic
1093253701 12:16839691-16839713 CCTACTGGGTGGAGGGTGGGAGG + Intergenic
1095099842 12:38169134-38169156 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1095555860 12:43503717-43503739 CCTACTTGAGGGTGGATGGTGGG - Intronic
1096559274 12:52424201-52424223 GCATCTGGAGGGAGGGAGGGAGG + Exonic
1096755522 12:53796320-53796342 CCACCTTGACGGAGGGCGGGTGG + Intergenic
1097042493 12:56164238-56164260 CCACCTGGAGGGAGGGTGAGCGG - Intronic
1097189522 12:57212811-57212833 CGTTCTGGTGGGAGGGTAGGAGG - Exonic
1097273425 12:57793996-57794018 TATCCTTGATGGAGGGTGGGTGG + Intronic
1098785255 12:74745298-74745320 CCTGCTTGAGGGAGGAGGGTAGG - Intergenic
1099372031 12:81846094-81846116 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1099730949 12:86501488-86501510 GCCTGTTGAGGGAGGGTGGGCGG - Intronic
1100179870 12:92073654-92073676 CCTACTTGAGGGTGGGGGGGTGG - Intronic
1101946247 12:109139678-109139700 GCTTCTGGTGGGAGGGTGGTAGG - Exonic
1102458481 12:113085943-113085965 CCTTCTTGAGCAAAGGTGGAAGG + Intronic
1103058637 12:117841334-117841356 CGGTCCTGAGGGAGGATGGGAGG - Intronic
1104853774 12:131892388-131892410 CCCACTTGAGGGTGGGAGGGTGG + Intergenic
1105034075 12:132905566-132905588 CTATCTTAAGGGAGGGAGGGAGG + Intronic
1105851389 13:24339431-24339453 CTTTCTTGGGGGGGGGTGGGGGG + Intergenic
1106749847 13:32751029-32751051 CCTTCTTGAGGGTGGAGGGTAGG - Intronic
1107037884 13:35919893-35919915 CACTCTTGCGGGGGGGTGGGGGG + Intronic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107901951 13:45025582-45025604 AATTTTTGAGGGAGGGAGGGAGG - Intronic
1108129548 13:47283029-47283051 ACTTGTAGATGGAGGGTGGGAGG - Intergenic
1110020700 13:70466740-70466762 CCTACTTGAGGGTGGAGGGGAGG - Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1110406731 13:75159308-75159330 CCTGCTTGAGGGAGGAGGGTAGG + Intergenic
1110782018 13:79477683-79477705 CCTGCTTCTGGGAAGGTGGGAGG + Intergenic
1112684309 13:101805730-101805752 CCTGCTTGTGGGAAGGGGGGTGG - Intronic
1112736289 13:102423106-102423128 CCTACTTGAGGGAGGACGGGGGG + Intergenic
1113122273 13:106936217-106936239 CCTACTTGAGGCAGGGAGGGTGG + Intergenic
1113259646 13:108547381-108547403 CTTTCGTGAGGTTGGGTGGGGGG + Intergenic
1113992482 14:16038378-16038400 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1114212712 14:20628998-20629020 CCTTGATGAGGGAGGCTGTGGGG - Intergenic
1114528307 14:23379696-23379718 ACTTATTGGGGGAGGGGGGGTGG + Exonic
1114655257 14:24311784-24311806 ACCTCTGGAGGGTGGGTGGGGGG - Exonic
1115013787 14:28585032-28585054 CCTTCTTGAGGGTGGATGCTGGG - Intergenic
1115053555 14:29094446-29094468 CCAAATTGTGGGAGGGTGGGAGG - Intergenic
1115275541 14:31604697-31604719 CCTTTTTTTGGGAGGGTGGGGGG + Intronic
1116116744 14:40662360-40662382 CCTACTTGAGGGTGGGCTGGGGG - Intergenic
1117821353 14:59652670-59652692 CCTACTTGAGGGTGGGAGGAGGG + Intronic
1118651781 14:67903903-67903925 CCTACTTGAGGGTGGCTGGTGGG - Intronic
1118837219 14:69485558-69485580 CCGTCTTAAGGGTGGGTGGTTGG - Intronic
1119172693 14:72546911-72546933 CTTTCCTGAGAGTGGGTGGGAGG - Intronic
1119762686 14:77163096-77163118 GCCTCTTGAGGGAAGGTAGGAGG - Intronic
1120891146 14:89492339-89492361 CCATCTTTGGGGTGGGTGGGAGG - Intronic
1121423541 14:93832412-93832434 TGATCTTGAGGGAGGGAGGGAGG + Intergenic
1121735647 14:96216325-96216347 ACTTCTTGCGGGGAGGTGGGAGG - Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122856569 14:104563044-104563066 GCTCCCTGAGGGAGGGAGGGAGG + Intronic
1122931910 14:104937000-104937022 CCAGCTGGAGGGAGGGAGGGAGG + Exonic
1123135395 14:106022884-106022906 GCTTCTGGAGGGAGGATTGGGGG + Intergenic
1123568627 15:21578768-21578790 ACTTCTATAGGGAGGGAGGGAGG + Intergenic
1123604736 15:22014090-22014112 ACTTCTATAGGGAGGGAGGGAGG + Intergenic
1123755488 15:23394671-23394693 CCTGCAGGAGGAAGGGTGGGGGG + Intergenic
1124020868 15:25921698-25921720 CCTTTTGGAGGGTGGGTGGGAGG - Intergenic
1124122620 15:26903108-26903130 CCTTCTTGAGGGTGGAGGGTGGG - Intronic
1124531395 15:30510840-30510862 TCTTGTTGGGGGAGGGTGGGAGG - Intergenic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1124767260 15:32496856-32496878 TCTTGTTGGGGGAGGGTGGGAGG + Intergenic
1125038928 15:35160603-35160625 CCTACTTGAGGGAGTGTGAGAGG - Intergenic
1125302985 15:38277268-38277290 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1125394033 15:39227287-39227309 CCTTCATGGAGGATGGTGGGTGG + Intergenic
1125843159 15:42824711-42824733 ACTTCAGGATGGAGGGTGGGAGG + Intronic
1126223763 15:46245482-46245504 GCTTGATGGGGGAGGGTGGGAGG - Intergenic
1126236895 15:46396087-46396109 GCTTCTTGGGGGAGGGCAGGAGG + Intergenic
1126502482 15:49361396-49361418 CCTACTTGAGGGAGGAGGGAAGG - Intronic
1127477071 15:59344732-59344754 CCTGCTTGGGGAAAGGTGGGAGG - Intronic
1127803874 15:62500741-62500763 CCTTCTTGAGGGAGCGCTGTTGG + Intronic
1127902978 15:63354832-63354854 ACTTCCTGAGGGTGGGTGGAGGG - Intronic
1128089953 15:64912529-64912551 ACTCCTTGAGGGAGGTTCGGAGG - Intronic
1128888934 15:71313481-71313503 GCTTGCTGAGGGAGGGTCGGGGG + Intronic
1128926878 15:71664645-71664667 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1129210562 15:74065639-74065661 CATTCTTGGTGGGGGGTGGGAGG - Intergenic
1129403449 15:75299690-75299712 CATTCTTGGTGGGGGGTGGGAGG + Intergenic
1130207129 15:81887610-81887632 CATTAGTGAGGGAGGATGGGTGG - Intergenic
1130282543 15:82531227-82531249 CATGCTTGGTGGAGGGTGGGAGG + Intergenic
1131896150 15:97031990-97032012 CCTTCTGGAGGGTGGATGGTAGG + Intergenic
1202976982 15_KI270727v1_random:305855-305877 ACTTCTATAGGGAGGGAGGGAGG + Intergenic
1132618713 16:854553-854575 CCTACTTCAGGGACCGTGGGTGG - Exonic
1132936336 16:2483166-2483188 CTTTCTTGGGGTAGAGTGGGTGG + Intronic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133224685 16:4335253-4335275 CCTGCTCCAGGGAGGGCGGGGGG - Exonic
1133691083 16:8216016-8216038 AGTTCTTCAGGGAGGGTGGATGG - Intergenic
1133809373 16:9149299-9149321 CCTTCTTTCGGGATGGTGGTGGG + Intergenic
1134360572 16:13527296-13527318 CCTTGTAGATGGAGGGAGGGAGG - Intergenic
1134391899 16:13827730-13827752 CCTTCTTGAGGGTGGAGGGTCGG - Intergenic
1134766666 16:16764858-16764880 CCTGCTTGAGGGAGGAGGGTGGG - Intergenic
1134810273 16:17161284-17161306 ACATCTTGGGGGAGGGAGGGTGG + Intronic
1135007460 16:18839341-18839363 CCTACTTGAGGGTGGGGGGCAGG - Intronic
1135160069 16:20086321-20086343 CCTTCTTGAGGGACCGCTGGAGG + Intergenic
1135845874 16:25918009-25918031 TCTTTTTGAGATAGGGTGGGGGG + Intronic
1135915325 16:26600418-26600440 ACTTCTTGTGGGAGGATGAGTGG + Intergenic
1136000349 16:27287789-27287811 ACTTCTAGAGGGAGGATGGTAGG + Intronic
1136530442 16:30864844-30864866 CCTTCTTAAGGGTGGGGGGGTGG - Intronic
1136534789 16:30893286-30893308 TCTCCCTGTGGGAGGGTGGGGGG + Exonic
1136911863 16:34150286-34150308 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1137603755 16:49773846-49773868 CCTGCTTGAGGGAGGCAAGGAGG + Intronic
1137729801 16:50681089-50681111 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1137842663 16:51654258-51654280 ACTTCTTGAGTGAGGTTGTGGGG + Intergenic
1138631537 16:58298437-58298459 CCTTCTTGAGGGTGAGAGGTGGG - Intronic
1138676742 16:58656779-58656801 CCGTCTTGGGGCGGGGTGGGGGG + Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139657555 16:68398032-68398054 GCTTCGTCAGGGAGGGAGGGAGG + Intronic
1139933917 16:70553339-70553361 CCTTCATGTGGGTGGGTGGGTGG + Intronic
1140018301 16:71210496-71210518 CCTACTTGAGGGAGGAGGGTGGG + Intronic
1140407731 16:74722105-74722127 CCCTTGGGAGGGAGGGTGGGAGG - Intronic
1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG + Intergenic
1141044768 16:80706286-80706308 CATTCTTGTGTGAGGGTGGAGGG - Intronic
1141089429 16:81120118-81120140 CCTTCTTAAGAGTGGGTAGGAGG - Intergenic
1141463946 16:84194868-84194890 GCTTCCTGAGGGACGGAGGGTGG + Intronic
1141626468 16:85264142-85264164 ACCTGTTGTGGGAGGGTGGGGGG + Intergenic
1141694270 16:85612372-85612394 CCTGGGTGAGGTAGGGTGGGGGG + Intronic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1142688927 17:1593113-1593135 CCCTCTTCAGAGAGGGTGGAAGG + Intronic
1142765211 17:2060616-2060638 TATTCTGGAGGGAGGGTAGGCGG + Exonic
1142767777 17:2075298-2075320 TCTTCAGGAGGGCGGGTGGGCGG + Intronic
1143086382 17:4419074-4419096 CCGTCTTGCGGGGGGGAGGGTGG + Intergenic
1143154583 17:4828046-4828068 CCATAGTGAGGGGGGGTGGGCGG + Intergenic
1143190106 17:5034465-5034487 CCTTCCAGAGGGTGAGTGGGAGG - Exonic
1143867427 17:9934287-9934309 CCTTCCTGAGGCAGGATGGTGGG + Intronic
1144140511 17:12342797-12342819 CCTGCTGGAGGGATGGGGGGAGG - Intergenic
1144495229 17:15741568-15741590 CCATCTGTAGGGAGGGAGGGTGG - Intronic
1144587315 17:16495043-16495065 CCTGCTTGAGGGTGTGTGGTTGG + Intergenic
1144766886 17:17737970-17737992 CCTTCTGGGGCCAGGGTGGGGGG - Intronic
1145005961 17:19337897-19337919 CCTTAGTGGTGGAGGGTGGGAGG + Intronic
1145720782 17:27070509-27070531 CCTACTTGAGGGTGGGAGGTGGG + Intergenic
1146736714 17:35244341-35244363 GATGCTTGAGGGAGGATGGGGGG + Intronic
1146831158 17:36070583-36070605 CCCTCGGGAGGGAGGATGGGAGG + Intronic
1147185857 17:38712803-38712825 CCTTCAGGAGGGATGGTGTGTGG + Intronic
1147660041 17:42112501-42112523 CCCACTTGAGGGAGGTGGGGGGG + Intronic
1147801849 17:43096978-43097000 CCTACTTGAGGGAGGAAGGTGGG + Intronic
1147975670 17:44246933-44246955 CCTTCTTGAGGGAGTAGAGGGGG - Intergenic
1148092708 17:45032243-45032265 TCTTCTTGAGGGAGGCAGGGAGG + Intronic
1148134431 17:45283221-45283243 CCCTCTTGAGAGGTGGTGGGAGG - Intronic
1148158317 17:45436055-45436077 CCTTTCTGAGGGAGGGGAGGCGG + Exonic
1148249187 17:46059926-46059948 CCATCTTGGGGGAGGGGAGGGGG + Intronic
1148327255 17:46790448-46790470 CAACCTTGAGGGAGGGAGGGAGG - Intronic
1148389345 17:47259332-47259354 CTTTTTTTTGGGAGGGTGGGTGG + Intronic
1148463064 17:47849117-47849139 CCTGCTTGAGGGAAGGGGGTGGG - Intronic
1148942736 17:51228891-51228913 CCTTCTCGGGGGTGGGTGGGTGG + Intronic
1150185754 17:63179783-63179805 CCTTATTTTGGGAGGGTGAGGGG - Intronic
1150478985 17:65495314-65495336 CATTTTTGAGGGAGTGGGGGTGG - Intergenic
1150917586 17:69452106-69452128 GCTTCTCAACGGAGGGTGGGAGG + Intronic
1151529154 17:74693318-74693340 CCTTTGAGAGGGAGGGTGGATGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152408017 17:80108450-80108472 ACTTCATGAGGGAGGGAGGAGGG - Intergenic
1152519810 17:80848845-80848867 CTTCCTTGAGGGAGTGTGGGTGG - Intronic
1152819555 17:82429795-82429817 CCATCTAGAGAGAGAGTGGGAGG - Intronic
1152882098 17:82823533-82823555 CGTTCTACAGGGAGGGAGGGAGG - Intronic
1153141828 18:1981349-1981371 CCTACTAGAGGGAGGATGGAAGG - Intergenic
1153284922 18:3448732-3448754 TTTTTTTGAGGGAGGGTGGCAGG + Intronic
1154079780 18:11244779-11244801 TTTTCTTGAGGGAGATTGGGAGG - Intergenic
1155258279 18:24017108-24017130 CCTTTTTTAGAGATGGTGGGAGG + Intronic
1156521055 18:37722656-37722678 CCTTGTTGAGGGAGGGTCTGTGG + Intergenic
1156699513 18:39808771-39808793 CCTACTTGAGGGGGGGAGGGTGG - Intergenic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157544405 18:48538031-48538053 CCAACTGGATGGAGGGTGGGTGG - Intergenic
1157826104 18:50813829-50813851 CCTACTTGAGGGTTGGAGGGTGG + Intronic
1158586009 18:58735661-58735683 CCTATTTGAGGGTGGGTGGGTGG + Intronic
1159116125 18:64114983-64115005 CCTGCATGGAGGAGGGTGGGAGG - Intergenic
1159889157 18:73938532-73938554 CCTTACTGAGGAAGGGTGGGTGG - Intergenic
1159923288 18:74246085-74246107 CTAGCTTGAGGGTGGGTGGGTGG - Intergenic
1160171678 18:76560697-76560719 CCTTAACGATGGAGGGTGGGAGG + Intergenic
1160239311 18:77111735-77111757 CTCTCTGCAGGGAGGGTGGGCGG - Intronic
1160341033 18:78088854-78088876 CCTCCAGGAGGCAGGGTGGGTGG + Intergenic
1160464623 18:79066063-79066085 AGTTCTTGAGTGAGGGTGAGGGG + Intergenic
1160913016 19:1483498-1483520 CCTGCTGGGGGGTGGGTGGGCGG + Intronic
1161154155 19:2723495-2723517 CCTTTGTGAGTGGGGGTGGGTGG + Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1162782028 19:13011493-13011515 ACTTCAGGAGTGAGGGTGGGTGG + Intronic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1164432217 19:28198408-28198430 CCTTCCTGATGGAAGGTTGGGGG - Intergenic
1165170599 19:33889175-33889197 GGTTCTTGGCGGAGGGTGGGAGG + Intergenic
1166182168 19:41116656-41116678 CCATATTGAGGGAGGGGGTGAGG + Intronic
1167975989 19:53226264-53226286 CCGTCTCGGGGGGGGGTGGGGGG + Intergenic
1168165671 19:54545799-54545821 CCTTCTTGGCGGGGGGTGGGTGG - Intergenic
1168650061 19:58087033-58087055 CCTTCTCTAGGGCAGGTGGGAGG - Intronic
925809241 2:7682725-7682747 CCTGCATGTGGGTGGGTGGGTGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926841752 2:17088829-17088851 CATTTTTCAGTGAGGGTGGGAGG + Intergenic
926908424 2:17827343-17827365 TCTCCTTGAGGGAGGGAAGGTGG + Intergenic
926929110 2:18018363-18018385 GCTTGAGGAGGGAGGGTGGGAGG - Intronic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928693549 2:33825216-33825238 CCTACTTGAGGGTGAGTGAGGGG - Intergenic
930083807 2:47477913-47477935 CCTTTGTGTGGGAGGGAGGGAGG - Intronic
930365616 2:50435795-50435817 CCTTCTTGAGGGTGGAGGGAAGG + Intronic
930456458 2:51613188-51613210 TCTTCTTGGGGAAGGGTGGGAGG + Intergenic
930928251 2:56847995-56848017 CCTTCCTGTTGGAGGGTGGCTGG + Intergenic
931494616 2:62789445-62789467 CCTTTTGGTGGGTGGGTGGGTGG - Intronic
932226965 2:70049186-70049208 CTTACTTGAGGGAGGGGGGAGGG - Intergenic
933749153 2:85591960-85591982 CCTTCTTGAGGGCCAGTGTGGGG + Intronic
934704094 2:96464253-96464275 CCTTCCTGAGCTAGGGTGAGAGG - Intergenic
934753004 2:96806084-96806106 CCTCCGGGAGGGAGGTTGGGGGG - Intronic
934789267 2:97044532-97044554 GCTTCTTGAGAGAGTGTGGGAGG - Intergenic
934817211 2:97338009-97338031 GCTTCTTGAGAGAGTGTGGGAGG + Intergenic
934820485 2:97370475-97370497 GCTTCTTGAGAGAGTGTGGGAGG - Intergenic
935109612 2:100080549-100080571 TCTTCTAAAGGGAGGGAGGGAGG + Intronic
935831034 2:107000663-107000685 CCTTAGAGAGGGAGGATGGGAGG + Intergenic
936648826 2:114403040-114403062 CTTCCTTGAGGGTGGGTGGCTGG + Intergenic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
941268567 2:163395846-163395868 CTTCCTGGAGGGAGGGAGGGGGG + Intergenic
941424815 2:165329301-165329323 CCTTTGTGAAGGATGGTGGGAGG + Intronic
942908559 2:181213076-181213098 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
942963993 2:181867155-181867177 CCTTGATGGGGGAGGGTGAGAGG + Intergenic
944058020 2:195543863-195543885 CCTACTTGAGGGTGGATGGTGGG + Intergenic
944580694 2:201130160-201130182 TCTTCCTGAGGCTGGGTGGGTGG + Intronic
944603762 2:201330912-201330934 ACTTCCTGTGGGAGGGTGGAGGG - Intronic
947975085 2:234358358-234358380 CCTACTTGAGGGTGGGAGGTTGG - Intergenic
948386525 2:237584186-237584208 CTTTCTTGGGTGGGGGTGGGGGG - Intronic
948599626 2:239100881-239100903 CCTTCCAGAGGGACGGTGGAAGG + Intronic
948954366 2:241275179-241275201 CTTTCCTGAGGCGGGGTGGGGGG - Intronic
1168861450 20:1048716-1048738 CCCTCTTGATGGAGAGTGGCAGG - Intergenic
1168959402 20:1858430-1858452 CCTTCTTGAGGGAGGAGAGCGGG - Intergenic
1170192078 20:13654361-13654383 CCCTCTTGAGGGAAGGGGGCTGG - Intergenic
1170196818 20:13697427-13697449 CCTTTTTGGGGAAGTGTGGGAGG - Intergenic
1170304232 20:14919976-14919998 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1170653231 20:18261876-18261898 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1171769367 20:29310768-29310790 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1171981798 20:31633736-31633758 CCTTTTTCAGGGTGGCTGGGAGG - Intergenic
1172955044 20:38750429-38750451 CCTTCTGGAGGGAGTTGGGGTGG + Intronic
1173294735 20:41747032-41747054 CCTTGATGAGGGTGGCTGGGAGG + Intergenic
1173652612 20:44676516-44676538 CCTTCTTAAGGGTCGGGGGGGGG - Intergenic
1173704603 20:45100790-45100812 CCTCCTTGGCGGGGGGTGGGGGG + Intronic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1174552180 20:51369987-51370009 CCATCTTGATGGTGGGTGGGAGG - Intergenic
1174631354 20:51960794-51960816 TGTTCTTGAGGGAAGGTTGGGGG - Intergenic
1174760251 20:53200162-53200184 GCTTCTTGTGGGCGGGTGGAGGG + Intronic
1175381595 20:58567777-58567799 CCTTCTTTAGAGAGGGGTGGGGG - Intergenic
1175614487 20:60383546-60383568 CCTACTTGATGAAGGGCGGGAGG - Intergenic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176551895 21:8226769-8226791 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176552273 21:8231207-8231229 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176570804 21:8409768-8409790 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176571178 21:8413783-8413805 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176578712 21:8453915-8453937 TCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176579092 21:8458345-8458367 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176864770 21:14041004-14041026 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1176934570 21:14851284-14851306 CCTACTTGAGGGTGGGAGGATGG - Intergenic
1178641577 21:34348879-34348901 CCTACTTGAGGGTGGATGGTGGG + Intergenic
1180314789 22:11269139-11269161 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1180340588 22:11614565-11614587 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1182067919 22:27443501-27443523 CCTTGAGGAGGGAGGGTGGGAGG - Intergenic
1182552267 22:31106827-31106849 CCTGGTTGGGGGAGGATGGGAGG + Intronic
1182569512 22:31226025-31226047 CCAGCTGGAGGCAGGGTGGGGGG + Intronic
1182572265 22:31248313-31248335 CCTGAATGAGGGAGGGAGGGAGG - Intronic
1183204324 22:36408167-36408189 CCTGCTTGAGGGAGAGCAGGAGG - Intergenic
1183758350 22:39791885-39791907 CCTACTTGAGGGAGGAGGGTGGG - Intronic
1184525292 22:45019213-45019235 CCTTCCCGATAGAGGGTGGGAGG - Intergenic
1203256915 22_KI270733v1_random:143688-143710 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203257279 22_KI270733v1_random:147981-148003 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
949773720 3:7607881-7607903 CCTACTTGGGGGAGGGTGAGAGG - Intronic
949817776 3:8078406-8078428 AGGTATTGAGGGAGGGTGGGAGG - Intergenic
950279298 3:11692734-11692756 TTTTTTTGAGGGGGGGTGGGGGG + Intronic
950442003 3:13015761-13015783 CCTTTTGGAGGGCAGGTGGGCGG - Intronic
950465358 3:13150004-13150026 GGTTCTAGAGGGAGAGTGGGAGG + Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
950691551 3:14662332-14662354 ACTTCTTGAAGGGGGGCGGGGGG - Intronic
950909543 3:16574677-16574699 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
951757268 3:26104596-26104618 CCTCCTGGTGGGTGGGTGGGGGG + Intergenic
951842658 3:27050773-27050795 CCTTCTAGAGATAGGGTAGGGGG - Intergenic
952823458 3:37505130-37505152 CCTTCTTGTAGGAGGGAGTGTGG + Intronic
953079636 3:39603748-39603770 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
953138570 3:40205646-40205668 GCTTTTGCAGGGAGGGTGGGAGG - Intronic
954274731 3:49534845-49534867 CCTGATTGAGGGTGGGTGGGTGG + Exonic
954478657 3:50775741-50775763 CTTGCTGGAGGGAGGGTGGAAGG - Intronic
955433011 3:58870086-58870108 CCTTGTAGAGGGAGGGAGGGAGG - Intronic
955835225 3:63047303-63047325 GGTTCCTGTGGGAGGGTGGGAGG - Intergenic
955971815 3:64444754-64444776 CCTGCTTGGGGAAGGGTGCGCGG + Intronic
956712306 3:72049333-72049355 CCATCTTGAGGGTGGAGGGGTGG + Intergenic
956854945 3:73266949-73266971 CCTACTTGAGGGTGGGGGGGTGG + Intergenic
957505881 3:81119871-81119893 ACTTGGTGAGGGAGGTTGGGAGG + Intergenic
958108951 3:89114603-89114625 CCGTCCCGAGGTAGGGTGGGTGG + Intronic
958564941 3:95797582-95797604 CCTTAATGAGGGTGGATGGGAGG - Intergenic
959773344 3:110126106-110126128 CCATCTTGTGGGTGGGTTGGTGG - Intergenic
960384826 3:117010231-117010253 ACTTCTTGTGGGAAGGCGGGGGG - Intronic
960736320 3:120784970-120784992 CCTTCTTGAGGGTGGAAGGTGGG - Intergenic
961109624 3:124272958-124272980 CCTTCTGGTGGGAGGCTGGTTGG + Intronic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
961554796 3:127690460-127690482 GCTGCTGGAGGGAGGGTGGAGGG + Exonic
961648973 3:128408097-128408119 GCTTCTTGAGGGCGGGTGTCAGG - Exonic
962797655 3:138863016-138863038 CCGTGTTGAAGCAGGGTGGGCGG + Intergenic
962922629 3:139964654-139964676 CCTTCTGGAGGGAGTGAGGTGGG + Intronic
963056102 3:141187574-141187596 CCATCTTGGGGTGGGGTGGGAGG - Intergenic
963102964 3:141623319-141623341 CCTTCAAGAGGCAGGGTGGAGGG - Intergenic
964487057 3:157196931-157196953 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
965334216 3:167416200-167416222 ACTTGAGGAGGGAGGGTGGGAGG - Intergenic
965725921 3:171715918-171715940 CCTACTTGAGGGTGGGGGGTGGG - Intronic
967184794 3:186935156-186935178 CCTTCTTGAAGGGTGGAGGGTGG - Intronic
968651528 4:1762054-1762076 AGGTCTTGAGGGAGGGTGAGGGG - Intergenic
969339844 4:6533326-6533348 CTTGTTTGAGGGAGGCTGGGAGG - Intronic
970678648 4:18481997-18482019 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
970945301 4:21683968-21683990 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
972377195 4:38483634-38483656 CCTCCTTGAGGGTGGGAGGTGGG - Intergenic
973026370 4:45277314-45277336 CCTTACTGTAGGAGGGTGGGAGG - Intergenic
973808054 4:54544604-54544626 CCTCCATGAGGGTGGGTGGCCGG - Intergenic
975152587 4:71037043-71037065 CCTTCTTAAGGGCAGGGGGGTGG - Intergenic
975152601 4:71037087-71037109 CCTTCTTAAGGGCAGGGGGGTGG - Intergenic
976181431 4:82403182-82403204 ATTTCTTGAGGGAGGATAGGAGG + Intergenic
977543014 4:98340867-98340889 ACTTGAGGAGGGAGGGTGGGAGG + Intronic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
978503392 4:109433281-109433303 CCTCTTCGAGGAAGGGTGGGTGG + Intergenic
979191103 4:117859731-117859753 ACTTGATCAGGGAGGGTGGGAGG + Intergenic
980009734 4:127581616-127581638 CCTGCTTGAGGGAGGGTGCATGG + Intergenic
980024220 4:127745955-127745977 TCTACTTGAGGGTGGGTGGTGGG - Intronic
980120239 4:128720538-128720560 CCTCCTTCAGGGAGGGGGAGGGG + Intergenic
980244746 4:130224377-130224399 CCTGCTGGAAGGAGGGAGGGAGG + Intergenic
980302973 4:131017811-131017833 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
980933937 4:139208229-139208251 CCACATTGAGGGTGGGTGGGTGG + Intergenic
981062770 4:140444369-140444391 CTTACTTGAGGGAGGATGGTAGG - Intronic
981512454 4:145572681-145572703 CCTACCTGAGGGTGGGGGGGGGG + Intergenic
983428672 4:167620000-167620022 CATTCTTGAGCCTGGGTGGGGGG + Intergenic
983664709 4:170167926-170167948 CCTCCTGGAGGGAGGATGTGAGG - Intergenic
983971852 4:173885238-173885260 CCTAATGGAGGGAGGGTGAGGGG - Intergenic
986464945 5:8011785-8011807 GCTTCTTGCAGGAGGGAGGGAGG - Intergenic
986936646 5:12896265-12896287 TCTACTAGAGGGAGGGAGGGAGG + Intergenic
988097996 5:26642468-26642490 CCTACTTGAGGGTGGATGGTGGG + Intergenic
988166960 5:27605183-27605205 ATTTCCTGAGGGACGGTGGGAGG - Intergenic
988837744 5:35049444-35049466 ACTTCTAGAGGGAAAGTGGGAGG + Intronic
989377758 5:40782847-40782869 CCTTCTTTTGGGTGGTTGGGGGG - Intronic
989998511 5:50864139-50864161 CACTCTCAAGGGAGGGTGGGTGG + Intergenic
990295045 5:54392987-54393009 CCTTCTTGAGGGAGGAGGCTGGG - Intergenic
990611321 5:57459607-57459629 CCTGCTTGAGGGAGGATAGTAGG + Intergenic
991590807 5:68249756-68249778 CCTGCTTGTGGTGGGGTGGGGGG + Intronic
991952749 5:71962675-71962697 GCTTCTTGGGAGAGGGTAGGAGG + Intergenic
992130967 5:73692694-73692716 CCTTCTGCAGGGAGGGCCGGAGG + Intronic
992226312 5:74622410-74622432 CCATCTGAAGGGTGGGTGGGGGG - Intergenic
992862115 5:80921529-80921551 CCCTCTTGAGGGAGGAGGGTGGG + Intergenic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
993139688 5:84016041-84016063 TCTACTTGAGGGTGGGTGGTGGG - Intronic
995099951 5:108288103-108288125 CCTACTTGAGGGTGGAAGGGAGG + Intronic
995839666 5:116431249-116431271 CCTTTTTGTGGGTGGGTGAGGGG - Intergenic
995849442 5:116529833-116529855 GCTGCTTGAGGGCGGGTTGGGGG + Intronic
997555307 5:134792401-134792423 GCTTCGTGAGGGAGCGGGGGCGG + Intronic
997747186 5:136309551-136309573 CCTTCTTGTGAAGGGGTGGGAGG + Intronic
1001647851 5:173295434-173295456 CCTCCTTGTGGGTGGGGGGGGGG + Intergenic
1001809720 5:174618503-174618525 CATGGTTCAGGGAGGGTGGGTGG - Intergenic
1002000863 5:176195675-176195697 CCTCATTGGGGGAGTGTGGGGGG + Intergenic
1002059783 5:176619559-176619581 CCTTCGTGGGGGTGGGAGGGTGG + Intergenic
1002064553 5:176645555-176645577 TCTGCTAGAGGGAAGGTGGGTGG + Intronic
1002866311 6:1125278-1125300 CCTTCTGGACTGAGGGTAGGTGG - Intergenic
1003293415 6:4802820-4802842 ACTTGTGCAGGGAGGGTGGGCGG + Intronic
1003643196 6:7892898-7892920 CCTTCTTGGAGAAGGGAGGGCGG + Intronic
1004117278 6:12781768-12781790 CCTCCTGGAGGGAGGGAGGGTGG + Intronic
1005325004 6:24691535-24691557 ACATCTTGGGGCAGGGTGGGGGG - Intronic
1005894312 6:30164498-30164520 TCTTCTTGAGAAAGGGAGGGTGG + Intronic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1006840734 6:37026603-37026625 CCTTCGTGAGGGAGGGGCAGTGG - Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1007733587 6:43966490-43966512 TGTTCTTGAGGTGGGGTGGGTGG - Intergenic
1007888191 6:45256576-45256598 ACTAGTGGAGGGAGGGTGGGGGG - Intronic
1008101986 6:47401584-47401606 CCTTCTTGTAGAAGGGTGGACGG + Intergenic
1008880539 6:56376830-56376852 CCTTGTTTGGGGGGGGTGGGGGG - Intronic
1009223593 6:61004016-61004038 CAATATTGGGGGAGGGTGGGGGG + Intergenic
1010187420 6:73159339-73159361 CCTACTTGAGGGTGGATGGTGGG + Intronic
1010188889 6:73174637-73174659 GCAGCTTCAGGGAGGGTGGGAGG - Intronic
1010206063 6:73323474-73323496 CTTTCCTGCAGGAGGGTGGGAGG - Intergenic
1010741315 6:79508475-79508497 CCTTCTTAAGTGGGGGTGGTGGG - Intronic
1011340455 6:86307723-86307745 GCTTCTTGGTGGAGGCTGGGGGG - Intergenic
1012591042 6:100981606-100981628 ACTTGAAGAGGGAGGGTGGGAGG - Intergenic
1012978450 6:105805019-105805041 CCAACTTGGGGGATGGTGGGAGG + Intergenic
1012998847 6:106000537-106000559 CCTTGGTGAGGGAGGGAGGGAGG - Intergenic
1013231976 6:108167918-108167940 CCTTCTTGGAGGGGGGTAGGAGG - Intronic
1013864456 6:114678480-114678502 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1015288845 6:131515009-131515031 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1016674774 6:146751127-146751149 GCATGTTGCGGGAGGGTGGGGGG - Intronic
1017220067 6:151955872-151955894 CCTACGTGAGGGAGGGTGAGAGG - Intronic
1017267691 6:152469082-152469104 CTTTTTTGGGGGAGTGTGGGGGG + Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018205869 6:161436454-161436476 CTTTTTTGGGGGGGGGTGGGCGG + Intronic
1018508457 6:164496561-164496583 ACTTGTTGAGGACGGGTGGGTGG + Intergenic
1018771534 6:166975303-166975325 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1019544151 7:1565155-1565177 CCTGCCCGAGGGAGGTTGGGTGG + Intergenic
1019608726 7:1924259-1924281 CCTTCTCGCGGCAGGGTGGCAGG + Intronic
1019714079 7:2530395-2530417 CCTTCTGGGGGGTGGGGGGGCGG - Intergenic
1020017943 7:4842448-4842470 CCTTCTCGAGGAGGGGAGGGGGG - Intronic
1020392056 7:7668915-7668937 CCTTTCTGAGTGAGTGTGGGTGG - Intronic
1020816997 7:12917825-12917847 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1021114134 7:16729381-16729403 CCGTCTTGAGGGGGGGCGGGGGG + Intergenic
1021802893 7:24325578-24325600 CTTTTTTGGGGGTGGGTGGGTGG - Intergenic
1021898026 7:25255985-25256007 CCTTCTATAGGGAGTGGGGGTGG - Intergenic
1024359531 7:48454373-48454395 CACTCTTGAGGGAGCGTGGCCGG + Intronic
1024445966 7:49479406-49479428 CATTCTTGAGGGTGGGGGGCTGG + Intergenic
1024524422 7:50336375-50336397 CCTTCTTTAGGAAGGGGTGGAGG + Intronic
1024713957 7:52053294-52053316 GCATCTGGAGGGAGGGAGGGAGG - Intergenic
1024848317 7:53677608-53677630 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1026739093 7:72967239-72967261 CCTTTTTTGGGGGGGGTGGGGGG + Intronic
1026821085 7:73549499-73549521 CCTTTTTTAGAGATGGTGGGGGG - Intronic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1026974769 7:74490548-74490570 CCTTCTGGAAGGCGGGCGGGGGG - Intronic
1027104638 7:75397834-75397856 CCTTTTTTGGGGGGGGTGGGGGG - Intronic
1028101258 7:86823768-86823790 TCTTTTTAAGGGAGGGTGGTGGG - Intronic
1028505875 7:91569511-91569533 CCTAATTGGGGTAGGGTGGGAGG + Intergenic
1028789774 7:94840850-94840872 ACTTCTAGAGGAAGGGTGGATGG - Intergenic
1029989293 7:104948321-104948343 TCTTCTTGGTGGAGGGTTGGAGG + Intergenic
1030349220 7:108464483-108464505 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1031017297 7:116588639-116588661 GCTTCGGGAGGGAGGGAGGGAGG - Intergenic
1031602679 7:123730948-123730970 CCTACTTGAGGGTGGGGGGTAGG - Intronic
1032452787 7:132047766-132047788 CTGTCTTGAAGGAGGGTGGGGGG - Intergenic
1032645622 7:133820750-133820772 GATTCTCCAGGGAGGGTGGGAGG + Intronic
1033144942 7:138863226-138863248 CCTCTGTGAGGAAGGGTGGGCGG + Intronic
1034333475 7:150304611-150304633 CTCACTTGAGGGAGGGAGGGAGG - Intronic
1034664568 7:152805279-152805301 CTCACTTGAGGGAGGGAGGGAGG + Intronic
1035412625 7:158657513-158657535 CATCCTTGAGGGAGGTGGGGGGG + Intronic
1035636068 8:1145273-1145295 CTTCCTGGAGGGATGGTGGGTGG - Intergenic
1035721622 8:1797249-1797271 TCTTCTGGAGGAAGGGTTGGTGG - Intergenic
1036143256 8:6227536-6227558 CCTTGTTGAGGGGGTGTGAGGGG - Intergenic
1037300938 8:17451364-17451386 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1038317503 8:26500217-26500239 CCTACTTGAGGGTGGGAGGAGGG + Intronic
1038406807 8:27328147-27328169 TCTTCTTGAGGGATGGTGGGTGG + Intronic
1038439044 8:27558930-27558952 CCTCTCTGAGGGAAGGTGGGAGG - Intergenic
1038945854 8:32359065-32359087 CCTGCTAGAGAGATGGTGGGTGG + Intronic
1038988646 8:32841596-32841618 CCTACTTGAGGGTGGGAGGAGGG - Intergenic
1039488273 8:37928060-37928082 CCTCCGGGAGGGAGGTTGGGGGG + Intergenic
1039807486 8:41013275-41013297 CCTACTTGAAGGTGGTTGGGTGG - Intergenic
1040449912 8:47534624-47534646 ACTTGAAGAGGGAGGGTGGGAGG + Intronic
1040784361 8:51148405-51148427 CTTTTTTGAAGTAGGGTGGGAGG + Intergenic
1041914036 8:63121690-63121712 CCTCCTTGAGGGAGGAGGGTGGG - Intergenic
1043949553 8:86292377-86292399 CCTTTTTGGGGGAGGGGGGATGG - Intronic
1044752813 8:95432211-95432233 CCCTTTTGTGGGAGGGAGGGTGG + Intergenic
1046333163 8:112748489-112748511 ACTTGATGCGGGAGGGTGGGAGG - Intronic
1047305527 8:123649952-123649974 CTCTCTTGAGGGAGGGGGAGTGG - Intronic
1047770500 8:128026752-128026774 GCTTCCAGAGGGAGGGTAGGTGG - Intergenic
1049167070 8:141133113-141133135 CCTTCTGCAGTGAGCGTGGGGGG + Intronic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049548433 8:143245671-143245693 CCCTACTGTGGGAGGGTGGGCGG - Intergenic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049856363 8:144864460-144864482 ACTTATTGAGGGAGGGTGCTAGG + Intergenic
1050841337 9:10152820-10152842 TCTTTTTGGGGGAGGGTAGGGGG - Intronic
1050885525 9:10760293-10760315 CATTCTAGAGGGTGTGTGGGGGG + Intergenic
1052856468 9:33410005-33410027 TCTTCTTGAGGGCGGGAGGAGGG - Intergenic
1055015936 9:71618195-71618217 CCTACTTGAGGGTGGGAGGAGGG + Intergenic
1055225905 9:73994898-73994920 CCTTTTTTTTGGAGGGTGGGGGG + Intergenic
1055797492 9:79990770-79990792 ATTTGTTGAGGGTGGGTGGGGGG + Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056254520 9:84785217-84785239 CCTGTGTGATGGAGGGTGGGAGG - Intronic
1056292735 9:85160343-85160365 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056292875 9:85161314-85161336 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056750063 9:89343493-89343515 CCTACTTGAGGGTGGGAGGAAGG - Intronic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057519742 9:95751653-95751675 GCTGCATGAGGGAGGGAGGGAGG + Intergenic
1057817164 9:98304221-98304243 CGGTCTGGAGGGATGGTGGGGGG + Intronic
1058102928 9:100937198-100937220 CCTTGATGAGGGTGGCTGGGGGG + Intergenic
1058884125 9:109310336-109310358 ACTTCAGGAGGGAGGGAGGGAGG + Intronic
1058947200 9:109868861-109868883 CATTCCTGAGGGAGGATGGAGGG + Intronic
1059379738 9:113913722-113913744 TGGTCTTGAGGGAGGGAGGGTGG + Intronic
1059495815 9:114708542-114708564 ACATCTTGGTGGAGGGTGGGGGG - Intergenic
1060065415 9:120496720-120496742 CGTTCGGGAGGGAGGTTGGGGGG + Intronic
1060406580 9:123375892-123375914 CCTTCCTGGGGCGGGGTGGGGGG + Intronic
1060818508 9:126648429-126648451 CCATCTTGATGGAGTGTTGGGGG + Intronic
1060890766 9:127186771-127186793 CCAACTGGAGGAAGGGTGGGGGG - Intronic
1061364984 9:130168002-130168024 ACTGCTTGGGGAAGGGTGGGGGG - Intergenic
1061679965 9:132238127-132238149 CTTTCTTGCTGGAGGGTGGGTGG + Intronic
1061679967 9:132238131-132238153 CTTGCTGGAGGGTGGGTGGGTGG + Intronic
1062021211 9:134320226-134320248 TCTGCTGGACGGAGGGTGGGGGG - Intronic
1203473073 Un_GL000220v1:125373-125395 TCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203473453 Un_GL000220v1:129803-129825 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203363096 Un_KI270442v1:235152-235174 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1186121988 X:6373309-6373331 CATTCTTGAGGGTGGGAGGTGGG + Intergenic
1186219679 X:7336242-7336264 CCTCCTTTGGGGCGGGTGGGGGG - Intronic
1186334505 X:8572282-8572304 CCTGCTTGGGGGAGGTGGGGAGG - Intronic
1186662541 X:11683595-11683617 CCTACTTGAGGGTGGGAGGAGGG + Intergenic
1187793508 X:22976946-22976968 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
1188807983 X:34614871-34614893 AGGTGTTGAGGGAGGGTGGGAGG - Intergenic
1188820660 X:34770845-34770867 CCATCTGGAAGGAGGGTGGGAGG - Intergenic
1188982637 X:36740639-36740661 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1189220044 X:39363731-39363753 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1189501093 X:41559844-41559866 CCCTCTGGAGGGGGGGTGGTGGG + Exonic
1189617322 X:42797041-42797063 ACTTCTTGAGGGGGTGTGGAGGG - Intergenic
1189720656 X:43912919-43912941 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1190054457 X:47173715-47173737 CCTGCAAGAGGGAGGGAGGGAGG - Intronic
1190453765 X:50606226-50606248 CCTTCATGAGGGGGGGAGGGGGG - Intronic
1190532106 X:51388917-51388939 CCTACTTGAGGGAGGAAGGTGGG + Intergenic
1190731765 X:53231279-53231301 CCTTCATCAGGGATGTTGGGGGG + Intergenic
1191046240 X:56140595-56140617 CCTACTTGAGGGTGGATGGTGGG + Intergenic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1191891109 X:65942310-65942332 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1193289690 X:79757171-79757193 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1194251398 X:91579739-91579761 CCTAGTTGAGGGTGGGTGGTGGG - Intergenic
1195318939 X:103705549-103705571 CCATATGGAGGGAGGGAGGGAGG + Intergenic
1195576353 X:106455701-106455723 CCTACTTGAGGGTGGGAGGTGGG + Intergenic
1196098330 X:111823346-111823368 CCATCTTCAGGGAAGGAGGGAGG - Intronic
1196303245 X:114070478-114070500 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1196394457 X:115244310-115244332 GCCTGTCGAGGGAGGGTGGGTGG + Intergenic
1196767608 X:119262389-119262411 CCTTTTGGAGGTAGGGAGGGAGG + Intergenic
1196810569 X:119625912-119625934 TCTTCTTGAGAGATGGTGGTTGG - Intronic
1198068433 X:133123364-133123386 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1198136680 X:133758541-133758563 GCTTGTTGAGGCAGGGAGGGAGG + Intronic
1198457924 X:136835658-136835680 GCTGCTTGAGGGAGGGAGGGAGG + Intergenic
1199296564 X:146165517-146165539 CCTACCTGAGGAAAGGTGGGAGG + Intergenic
1199310691 X:146316470-146316492 CCTACTTGAGGGAGGTTAGGAGG + Intergenic
1199619461 X:149686339-149686361 CTTCCTTGAGGGAAGTTGGGTGG + Intergenic
1199763791 X:150925923-150925945 CCTTTTTGGGGGGGGGCGGGGGG - Intergenic
1199875860 X:151927465-151927487 TCTACTTGAGGTAGGGAGGGTGG + Intergenic
1200235084 X:154464267-154464289 GCTCCTGGAGGGAGGGTGAGGGG - Exonic
1200243197 X:154508347-154508369 CCTAGTTGGGGGGGGGTGGGGGG + Exonic
1200359126 X:155583458-155583480 ACATGTTGTGGGAGGGTGGGAGG - Intronic
1200420184 Y:2956686-2956708 CCATCTTGGGGGCGGGGGGGGGG - Intronic
1200570339 Y:4820970-4820992 CCTAGTTGAGGGTGGGTGGTGGG - Intergenic
1201075230 Y:10181636-10181658 CCTACTTGAGGGAGGAAGGGTGG + Intergenic
1201386555 Y:13446166-13446188 CCTACTTGAGGGTGGATGGTGGG + Intronic