ID: 1152115827

View in Genome Browser
Species Human (GRCh38)
Location 17:78386462-78386484
Sequence CTCCTTCCCATAACTAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152115819_1152115827 -5 Left 1152115819 17:78386444-78386466 CCCAGCCCCCACCACTTCCTCCT 0: 1
1: 2
2: 9
3: 154
4: 1144
Right 1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG 0: 1
1: 0
2: 1
3: 12
4: 120
1152115821_1152115827 -10 Left 1152115821 17:78386449-78386471 CCCCCACCACTTCCTCCTTCCCA 0: 1
1: 1
2: 18
3: 343
4: 2109
Right 1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG 0: 1
1: 0
2: 1
3: 12
4: 120
1152115818_1152115827 -4 Left 1152115818 17:78386443-78386465 CCCCAGCCCCCACCACTTCCTCC 0: 1
1: 0
2: 31
3: 274
4: 2172
Right 1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG 0: 1
1: 0
2: 1
3: 12
4: 120
1152115820_1152115827 -6 Left 1152115820 17:78386445-78386467 CCAGCCCCCACCACTTCCTCCTT 0: 1
1: 2
2: 10
3: 168
4: 1421
Right 1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152115827 Original CRISPR CTCCTTCCCATAACTAGAAC TGG Intronic
905918732 1:41704571-41704593 CTCCTTCCCATAAGCAGGACAGG - Intronic
907091713 1:51731111-51731133 CACCTTCCCTGAACTAGAAAAGG - Intronic
907634333 1:56118310-56118332 CTCCTTCCCTTAACTGAGACCGG - Intergenic
908237976 1:62165804-62165826 CTCCTTCACATGACTGGAAATGG - Intergenic
911757134 1:101571558-101571580 CTCCTTCTCATTTCCAGAACAGG - Intergenic
915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG + Intronic
919164805 1:193878492-193878514 CCCCCTCCCAAAACTAGACCAGG - Intergenic
921070938 1:211656960-211656982 CCCCTTCCCATGACCAGAAGGGG + Intergenic
922445055 1:225690146-225690168 CTACTTCCCATATCTAAAATTGG + Intergenic
923161600 1:231319007-231319029 CTCCCACCTATATCTAGAACTGG - Intergenic
924023382 1:239808632-239808654 CCGCTTCCTATAACTAGAAGTGG + Intronic
1065717723 10:28589114-28589136 CTTTTTCCCATAACTAAAAATGG - Intronic
1067247979 10:44562135-44562157 CTCCCTGCCATAAGTAAAACTGG + Intergenic
1067779271 10:49187460-49187482 TTCCTTCCCAGAACTTGCACTGG - Intronic
1067791753 10:49293543-49293565 CTCTTTCCCATAACGAGAACAGG - Intergenic
1068367289 10:56067956-56067978 CTCCTTCCCTTTACGAGAAGCGG - Intergenic
1069879944 10:71585882-71585904 TTCCTTCCCATAAATAACACTGG + Intronic
1071515494 10:86294204-86294226 CTCCTTGCCTTCACCAGAACCGG - Intronic
1075653530 10:124146052-124146074 CTCCTTCCTATTACAAGAATGGG + Intergenic
1079139797 11:17800826-17800848 CTCCTTGCTATATCTGGAACTGG - Intronic
1081498859 11:43645387-43645409 CTTTTTCCCACAAGTAGAACTGG + Intronic
1087589130 11:100162611-100162633 CTCATTCACACAACTAGATCAGG + Intronic
1090824048 11:130371060-130371082 CTCCTTCCCTTATTTAGAAACGG - Intergenic
1090912675 11:131135163-131135185 TTCCTTCCCATTGCTAGCACCGG + Intergenic
1091989902 12:4946870-4946892 CTTCTTCCCATCACTAGTGCAGG + Intergenic
1095486938 12:42695166-42695188 CTCCTCCACATAAGTGGAACAGG - Intergenic
1096552854 12:52384957-52384979 CTCTTTCCCTTAAAAAGAACTGG - Intronic
1097057923 12:56261146-56261168 CTCCATCCCCTAGCCAGAACCGG - Intergenic
1099657925 12:85519268-85519290 CTGCTTCTCATTAGTAGAACTGG + Intergenic
1099702227 12:86100719-86100741 TTCCTTACATTAACTAGAACTGG - Intronic
1100071765 12:90729669-90729691 CTCTTTCCCCTCACTAGAAATGG + Intergenic
1100559442 12:95733518-95733540 ATCCTTACCATAACTACAAAAGG + Intronic
1101837265 12:108304265-108304287 CTCCTTGCCATTACCAGGACTGG + Intronic
1104793058 12:131496035-131496057 CTCCCTCCCATTACTGGAAGTGG + Intergenic
1104926512 12:132316740-132316762 CTCCTTCCCATCACGAGCACTGG + Intronic
1107056986 13:36116612-36116634 ATCCTTCACATTACTAGAGCTGG + Intronic
1109504146 13:63277392-63277414 CACCTTCCCATAATTGAAACAGG + Intergenic
1120440908 14:84538090-84538112 CTCATCCCTATATCTAGAACTGG + Intergenic
1122941560 14:104983708-104983730 ATCCTGCCCACACCTAGAACTGG - Intergenic
1123501192 15:20882610-20882632 GTCCTTCCCATACAGAGAACTGG - Intergenic
1123558444 15:21456315-21456337 GTCCTTCCCATACAGAGAACTGG - Intergenic
1123594675 15:21893590-21893612 GTCCTTCCCATACAGAGAACTGG - Intergenic
1126543993 15:49852746-49852768 CTCCTTCCCAGATCTAGACAAGG + Intergenic
1126865927 15:52936775-52936797 CTCCTTTCATTGACTAGAACAGG + Intergenic
1128689291 15:69711006-69711028 CTCCCTGGCATAACTAGAGCTGG - Intergenic
1131524862 15:93144601-93144623 CTTCTTCCCATCTCTGGAACTGG + Intergenic
1202966794 15_KI270727v1_random:183465-183487 GTCCTTCCCATACAGAGAACTGG - Intergenic
1133764239 16:8825329-8825351 CTCCGTCTCAAAACTACAACAGG - Intronic
1138390998 16:56669770-56669792 CTCCCTCCCCTGACTAGAAAAGG + Intronic
1138850777 16:60627146-60627168 CTCCTTCCCATAACTGGTCTTGG - Intergenic
1139085695 16:63582944-63582966 TTCCTTCCAAGACCTAGAACTGG - Intergenic
1143995728 17:11004889-11004911 CAGCTGCCCATAACTAGAACTGG - Intergenic
1144514917 17:15910756-15910778 CCCCTTCCCATACCTGGAAAGGG + Intergenic
1144557213 17:16292867-16292889 CTCTTGCTGATAACTAGAACAGG - Intronic
1149428813 17:56580336-56580358 ATCCTTCACATAACTAAAACAGG - Intergenic
1151259643 17:72906419-72906441 TTCCTACCCAAAACCAGAACGGG + Intronic
1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG + Intronic
1156125788 18:33903727-33903749 GTCATTCCCATAACTAGACAAGG + Intronic
1156783757 18:40883419-40883441 CTCCTTCCCAGAATTAAAGCAGG + Intergenic
1158246257 18:55435634-55435656 CTCCTTCCCATCACTGGAAGAGG - Intronic
1160509095 18:79443471-79443493 CCCCTTCCCATGACAGGAACAGG - Intronic
1162987402 19:14279747-14279769 CTCCTTCCCAAAACCAAAATGGG + Intergenic
1163836910 19:19580513-19580535 CTCCTTCTGAAAACTGGAACAGG - Intronic
1166935826 19:46331968-46331990 CCCCCTCCCCAAACTAGAACAGG + Intronic
926068501 2:9864367-9864389 CACCTTCCCAAAACTAAACCAGG + Intronic
929202413 2:39250860-39250882 TTACTTCCCAGAGCTAGAACTGG - Intronic
935855505 2:107268785-107268807 CTCCTCCCCAGAACTATAAGTGG + Intergenic
939077619 2:137622757-137622779 CACCCTCCCAAAACTAAAACAGG + Intronic
942480718 2:176385610-176385632 CTCCTTCCCAGAACTTGTAGTGG + Intergenic
942523190 2:176825976-176825998 CACCTTCCCACATCTAAAACTGG - Intergenic
1171938739 20:31303272-31303294 CTCCTTCACATTTTTAGAACTGG + Exonic
1172498750 20:35409711-35409733 CTCCTTCCCAAAACCATCACTGG + Intronic
1176155917 20:63620384-63620406 CTCCATCCCCTACCTAGCACAGG + Intronic
1177683726 21:24409976-24409998 CTCCTTCCCTGAACTAGACAAGG - Intergenic
1177857541 21:26416490-26416512 CTCCCTTTCTTAACTAGAACAGG + Intergenic
1178482238 21:32989673-32989695 ATCCTTCCAATAACTAGGAATGG + Intergenic
1180859510 22:19069268-19069290 CTCCTTCCCTGAACCTGAACCGG + Intronic
1181939771 22:26466145-26466167 TTCCTTCGCATAACTTGTACAGG + Intronic
1183075972 22:35426909-35426931 CTCCTTCCCAGACCTGGAACTGG - Intergenic
1183133466 22:35863106-35863128 CACCTACCCATACCTAGCACAGG + Intronic
1183684713 22:39355089-39355111 CTCGCTCCAATAACGAGAACAGG + Intronic
956279321 3:67539772-67539794 CACCTTCCCATGACTAAACCAGG - Intronic
962732766 3:138298989-138299011 CTGTTTCCCATAACTACCACAGG + Intronic
962923866 3:139974374-139974396 CTCCTGCCCACATCTAGAAGTGG + Intronic
966084732 3:176056252-176056274 CTTCTTCACATACCTATAACTGG + Intergenic
969529368 4:7722212-7722234 CTCCTTCCCAGGATTAGCACAGG + Intronic
969576882 4:8041267-8041289 CTCCTTCCCCTACCCAGAACAGG + Intronic
975483869 4:74912929-74912951 CACCTTCCCACAACTAAATCAGG - Intergenic
975971035 4:80037244-80037266 CTCCTTTTCATAACTAGAATAGG + Intronic
978458099 4:108917886-108917908 ATCCTTCCCATAAATAGATATGG - Intronic
980543552 4:134227706-134227728 ATTCTTCCCATAACTAGACAAGG - Intergenic
981188391 4:141832988-141833010 CTACTTGCCATACCTAGAAAAGG - Intergenic
981310190 4:143290372-143290394 GTCCTACCCATTCCTAGAACTGG + Intergenic
989774113 5:45182246-45182268 TTCCTTCCAAAAACTAGAATTGG - Intergenic
991003727 5:61807810-61807832 TTCCTTCCCACAACAAGAACAGG - Intergenic
992721525 5:79565950-79565972 CTTCTTCCCCTATCAAGAACAGG - Intergenic
992788295 5:80190799-80190821 CTGGTTCCCATCACTAGAACTGG - Intronic
994466157 5:100134929-100134951 CTCTTTCCTAGTACTAGAACTGG + Intergenic
994798083 5:104332169-104332191 CTCTTTCCTATAACTAGTACTGG + Intergenic
998215164 5:140232620-140232642 TTCCTTCACAGAACAAGAACTGG - Intronic
998367682 5:141641333-141641355 CCCCTTCCCATTTCTAGAGCTGG - Exonic
999502451 5:152160540-152160562 CTCCTTCCCATAGCTAGGGGAGG - Intergenic
1001457344 5:171874593-171874615 CTCCTTTTCATAACCAGCACTGG - Intronic
1004935089 6:20499681-20499703 CTCCTTCCCAGAACCAGATGTGG - Intergenic
1007827057 6:44608385-44608407 CTCCTTCTCATACTCAGAACTGG - Intergenic
1008110999 6:47494605-47494627 CTCCTTGCCAGAACTATAAGGGG + Intronic
1008873319 6:56298641-56298663 CTCCTCACCTTAATTAGAACTGG - Intronic
1012571880 6:100739649-100739671 TACCTTCCCAAAACTAGATCAGG - Intronic
1012881515 6:104796408-104796430 CTCCTTAAGATAACTAGAATAGG - Intronic
1017829955 6:158117302-158117324 CTCCTTCCCATGTATACAACTGG + Intronic
1018910433 6:168098380-168098402 CTCCTAGCCATGACTAGAGCCGG - Intergenic
1019346681 7:534373-534395 CTGCGTCCCCTGACTAGAACGGG - Intergenic
1019884762 7:3894064-3894086 CTCCTTGCCATATTTAGAATGGG - Intronic
1020694457 7:11396558-11396580 CTCCCTCCCATGACTAAACCAGG + Intronic
1023119971 7:36899320-36899342 CTCCTTGCCTCAACTAGAGCAGG - Intronic
1029438921 7:100576901-100576923 CCCCTTCCCATAGCTGGACCAGG - Exonic
1036776975 8:11620061-11620083 ATCCTTCCCATCACTAGTATCGG - Intergenic
1039344139 8:36685235-36685257 CTCTTTCCCAGAAGTAGAAAGGG - Intergenic
1041556029 8:59157246-59157268 CTCCTTCCCTTAAATACAAGCGG - Intergenic
1042766167 8:72324390-72324412 CACCTTCCCAAAACTAAACCTGG + Intergenic
1045234361 8:100337188-100337210 CTCCTTCCCATTACTTGTGCTGG - Intronic
1047341123 8:123981338-123981360 CTCTTTCCCATAAGCAGAACCGG - Intronic
1047401226 8:124549201-124549223 ATCTTGGCCATAACTAGAACTGG + Intronic
1050702967 9:8361915-8361937 CTTCTTCCAATAGCTAGGACTGG + Intronic
1056487181 9:87071235-87071257 CCCCTTACAATAACTAGAAAAGG - Intergenic
1058374671 9:104308688-104308710 CACCTTCCCAAGACTAAAACAGG + Intergenic
1061270882 9:129541365-129541387 CTCCTTCCCATCAACAGAAAGGG + Intergenic
1188109793 X:26183627-26183649 CACCTTCCCAAAACTAAACCAGG + Intergenic
1193931282 X:87555431-87555453 CACCTTCCCAAGACTAAAACAGG - Intronic
1194152481 X:90342923-90342945 CTCCTTCCCAAAACTGAACCAGG - Intergenic
1195148117 X:102038635-102038657 CTCCTTCCCAAGACTAAACCAGG + Intergenic
1197778357 X:130135783-130135805 CTGCTGCCAATAAGTAGAACCGG + Intronic
1199512946 X:148642961-148642983 ATCCTTTCCACAACTAGAAATGG - Intronic
1200498828 Y:3919672-3919694 CTCCTTCCCAAAACTGAACCAGG - Intergenic