ID: 1152117268

View in Genome Browser
Species Human (GRCh38)
Location 17:78396198-78396220
Sequence TAGGATAGTTCAGCTTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152117264_1152117268 22 Left 1152117264 17:78396153-78396175 CCATACACGTTTCGAGCTTGCTT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1152117268 17:78396198-78396220 TAGGATAGTTCAGCTTGGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152117268 Original CRISPR TAGGATAGTTCAGCTTGGAG TGG Intronic
902346305 1:15820651-15820673 TTCGATAGTTCAGCTAGTAGAGG - Intergenic
904635623 1:31878598-31878620 GAGGAAAGTGCAGTTTGGAGAGG - Intergenic
911168701 1:94747524-94747546 TTGGATAGTTCTGGCTGGAGGGG + Intergenic
913233087 1:116758056-116758078 TATAATATTTCAGCTGGGAGAGG - Intronic
919424193 1:197408782-197408804 TAGGATAGTTCTGGTTGAACTGG + Intronic
920646808 1:207809793-207809815 TAGGACAGTTGAGGTTGGACAGG - Intergenic
921383961 1:214551433-214551455 GAGGATGGCTCAGCTGGGAGGGG + Intronic
924602823 1:245506589-245506611 TAGAATACTACAGATTGGAGGGG + Intronic
924870621 1:248040142-248040164 TAGGACTATTCAGCTTGGATTGG + Intronic
1065604746 10:27405949-27405971 TAGCATGCTTCAGCTAGGAGAGG + Intronic
1068301351 10:55145242-55145264 CAGGATATTTAAGCTTGCAGAGG + Intronic
1068951573 10:62782599-62782621 TGGGATGCTCCAGCTTGGAGGGG + Intergenic
1075056804 10:119224866-119224888 GAGGATGGTTTTGCTTGGAGAGG - Intronic
1080442488 11:32307863-32307885 TAGGAAAATTCTCCTTGGAGTGG + Intergenic
1080681773 11:34483517-34483539 TAGCATAGTACAGTATGGAGTGG - Intronic
1081151823 11:39642000-39642022 TAGGAAAAGTCAGCTAGGAGGGG + Intergenic
1082921652 11:58501543-58501565 TAGGAAAGTGAAGCTTGTAGAGG + Intergenic
1091712230 12:2750186-2750208 TAGGATGCTTGAGCTTGGTGGGG - Intergenic
1093774333 12:23054668-23054690 TAGGATAAATGAGCTTGGACTGG + Intergenic
1094328489 12:29266993-29267015 AAGGAAAGTTGAGTTTGGAGAGG - Intronic
1095582772 12:43819349-43819371 TAGGAAAGTTCAGCTTACAGTGG - Intergenic
1097916723 12:65028546-65028568 TTTGATAGTTCTCCTTGGAGAGG + Intergenic
1108171099 13:47742871-47742893 AAGGATAGTGCAGGGTGGAGGGG + Intergenic
1110000159 13:70187248-70187270 TAGGATACTGCAGCTAGGATTGG + Intergenic
1111427650 13:88109240-88109262 TGGCCAAGTTCAGCTTGGAGAGG + Intergenic
1112716145 13:102188448-102188470 GAGGAAATTACAGCTTGGAGAGG - Intronic
1113131515 13:107042466-107042488 TGGGACACTTGAGCTTGGAGGGG - Intergenic
1116053830 14:39838868-39838890 TAGGAAATTTCAGCTCAGAGAGG - Intergenic
1116978841 14:51146328-51146350 TAGAAAAGTTCAGTTTGTAGAGG + Intergenic
1119231049 14:72980113-72980135 TTGGAGAGTTCAGTTTGGAAAGG - Intronic
1121447225 14:93986956-93986978 TATGACAGTGCAGTTTGGAGGGG - Intergenic
1121654568 14:95585796-95585818 AGGGATTGTTCAGCTGGGAGGGG - Intergenic
1126949153 15:53860634-53860656 TAGGAATGTTTAACTTGGAGAGG - Intergenic
1127112170 15:55686375-55686397 TAAGATATTTCAGTCTGGAGAGG - Intronic
1135950561 16:26910162-26910184 AAGGAGAGGTCAGTTTGGAGAGG - Intergenic
1136586774 16:31191326-31191348 TAGGATATCTAGGCTTGGAGAGG + Intronic
1137576959 16:49606480-49606502 TGGGATAATTCAGGTTGGTGGGG - Intronic
1139588674 16:67920688-67920710 TAGGGAAGGTGAGCTTGGAGAGG - Intronic
1141982496 16:87559221-87559243 TAGGATATCTCAGCCTGGAGCGG - Intergenic
1150665869 17:67137228-67137250 TAGGATTGTTTGGCCTGGAGAGG - Intronic
1151378193 17:73706077-73706099 AAGGAAAGTTCTGCTTGGAGAGG - Intergenic
1152117268 17:78396198-78396220 TAGGATAGTTCAGCTTGGAGTGG + Intronic
1161989639 19:7677363-7677385 AAGGAGAGTTCAGATGGGAGAGG + Intronic
926608533 2:14922319-14922341 TAGGAAAGTCCAGAGTGGAGAGG + Intergenic
929931051 2:46255804-46255826 TAGGATAGTGAAAATTGGAGAGG - Intergenic
930537218 2:52658443-52658465 TAGGATAGTGCAGAGTGCAGAGG + Intergenic
932872039 2:75410724-75410746 TAGGATAGTCCTGTTTGGATTGG - Intergenic
937013255 2:118580748-118580770 TAGGAGAGTTTAGCTTGGAAAGG - Intergenic
938224276 2:129602444-129602466 TAGGATGATTGAGCTTGGAAAGG - Intergenic
948021335 2:234736239-234736261 CAGGATAGGTCAGCTGGCAGAGG - Intergenic
1169544515 20:6637004-6637026 TAGAATACTGAAGCTTGGAGAGG - Intergenic
1169682229 20:8228359-8228381 GAGGAAAGTGCAGCTTTGAGGGG - Intronic
1170167895 20:13380925-13380947 TGGGATGCTTGAGCTTGGAGGGG - Intergenic
1176220795 20:63968623-63968645 TAGGATAGTTCAGCCGGCACAGG - Intronic
1183307077 22:37088282-37088304 AAGGAGAGAGCAGCTTGGAGAGG + Intronic
1183371681 22:37436085-37436107 TAGAATTGTTCAGCTTGGAATGG - Intergenic
1183423305 22:37724610-37724632 TTGGATGGTTCTGCTGGGAGAGG - Exonic
950549433 3:13657261-13657283 TGGGGTGGCTCAGCTTGGAGGGG + Intergenic
954151240 3:48658284-48658306 TAGGAGAGTGCAGGTGGGAGAGG - Intronic
956913000 3:73840318-73840340 TAAAAAAGTTGAGCTTGGAGAGG + Intergenic
957760475 3:84548830-84548852 TTGGATATTTCAGCTTGCAGGGG - Intergenic
959998952 3:112710531-112710553 TAGTACAGTTCAGGTTGGGGAGG + Intergenic
961705336 3:128780724-128780746 TAGGATATTTTAGCATGAAGTGG + Intronic
964832549 3:160901266-160901288 TAGGAAAGTTCAGGTTTGGGTGG - Intronic
966238997 3:177734198-177734220 TGGGCTGGCTCAGCTTGGAGTGG + Intergenic
967535908 3:190603104-190603126 AAGGACAGTGCAGATTGGAGGGG + Intronic
969498040 4:7537267-7537289 TAGGATAGTGGAGCTTGAAGGGG - Intronic
972682774 4:41322807-41322829 GAAGATAGTTCTGCTTGGATGGG + Intergenic
973858208 4:55034545-55034567 GAGGAAAGTTAAGCTTGGAGAGG - Intergenic
975104119 4:70548889-70548911 TGGGACACTTCAGCTTGGTGGGG + Intergenic
975531181 4:75401180-75401202 TAAGATAGGTCAGCTGGGGGAGG + Intergenic
976608831 4:87007829-87007851 AAACATAGTTCACCTTGGAGAGG + Intronic
978154366 4:105473246-105473268 TGGGCTTGTTCAGCTTGGGGAGG + Intronic
983918221 4:173315190-173315212 AAGCATAGTTCATCTGGGAGTGG + Intronic
990231364 5:53716274-53716296 TGGGATGATGCAGCTTGGAGTGG + Intergenic
997191055 5:131936057-131936079 AAGGATAGCTCAGCTATGAGGGG - Intronic
998599310 5:143568949-143568971 TAGGAGAGTACAGCTTTTAGTGG - Intergenic
999685713 5:154101307-154101329 TACGATAGGTCAGCTGTGAGTGG - Intronic
999699257 5:154213312-154213334 TAGGAATGTTCGGCCTGGAGAGG - Intronic
1005662011 6:28007964-28007986 TAGGACATTTCAGCTGGGTGCGG - Intergenic
1007329494 6:41093866-41093888 TAGGAAAGTCCAGCCTGGTGTGG + Intronic
1011146340 6:84221860-84221882 TAGAGAAGTTCTGCTTGGAGTGG - Intronic
1011479086 6:87776368-87776390 TAGAATAGTTTAGCATGGATAGG + Intergenic
1015471875 6:133614903-133614925 TGGGATGCTTCAGCTTGGTGGGG + Intergenic
1015495074 6:133872989-133873011 AAGGAGAGTTCTGCTTGGACAGG + Intergenic
1016096845 6:140048426-140048448 GAGGATAGTTAAGTTTGCAGGGG - Intergenic
1016962951 6:149691041-149691063 GAGCATAATTCAGATTGGAGTGG - Intronic
1019599140 7:1872829-1872851 GAGGATCGTTCTGTTTGGAGAGG + Intronic
1019915262 7:4128821-4128843 TGGAATAGAGCAGCTTGGAGTGG + Intronic
1023511625 7:40959516-40959538 TGGGATACTCCAGCTTGGTGGGG - Intergenic
1024497074 7:50060750-50060772 TGGGATAGTTTAGCTAGGATTGG - Intronic
1032295930 7:130638576-130638598 TGGGATACTTGAGCTTGGTGTGG - Intronic
1033031222 7:137829061-137829083 TAAAATAGTTCAGCTTGTGGTGG - Intronic
1033527700 7:142232681-142232703 TAGGGGAGTTCAGCTGGGGGCGG - Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1037311713 8:17563189-17563211 CAGGATAGTTTAACTTGCAGTGG - Intronic
1037853995 8:22356571-22356593 TAGGAAAGTTCAAGTTGGGGTGG + Exonic
1044499078 8:92929868-92929890 TAGGTTAGTTAAGCTAGGATTGG + Intronic
1047652008 8:126933000-126933022 TAGTAAAGTTCAGATGGGAGGGG - Intergenic
1051252674 9:15177715-15177737 TAACATAGTTCAGCTTGCAAGGG + Exonic
1051670470 9:19504921-19504943 TGGGATACTTGAGCTTGGTGTGG - Intergenic
1052096586 9:24391329-24391351 TAGGATGCTTGAGCTTGGTGCGG - Intergenic
1053263223 9:36689791-36689813 TAGGATAGTGGAGATTGGAAGGG + Intergenic
1190282094 X:48937659-48937681 GAGGACATTTCAGCTTAGAGAGG - Intronic
1192611182 X:72568865-72568887 TAGGATAGTTAAGCCTAAAGTGG - Exonic
1194098587 X:89674408-89674430 TGGGATACTTGAGCTTGGAGGGG + Intergenic
1198648904 X:138839097-138839119 TAGGTTAGTTAAGGTAGGAGTGG + Intronic
1198845783 X:140908830-140908852 TGGCATAGTTGAGGTTGGAGCGG - Intergenic
1200451609 Y:3335783-3335805 TGGGATACTTGAGCTTGGAGGGG + Intergenic
1201961925 Y:19690328-19690350 TGGGATGCTTAAGCTTGGAGCGG - Intergenic