ID: 1152123532

View in Genome Browser
Species Human (GRCh38)
Location 17:78433113-78433135
Sequence GAGAGTGAGGAGGAGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 975
Summary {0: 1, 1: 1, 2: 17, 3: 140, 4: 816}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152123526_1152123532 2 Left 1152123526 17:78433088-78433110 CCATGTCGCTATTGATTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG 0: 1
1: 1
2: 17
3: 140
4: 816
1152123523_1152123532 25 Left 1152123523 17:78433065-78433087 CCTTGCTCTCTCTGAGCCAGGGT 0: 1
1: 1
2: 3
3: 47
4: 392
Right 1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG 0: 1
1: 1
2: 17
3: 140
4: 816
1152123520_1152123532 30 Left 1152123520 17:78433060-78433082 CCGGACCTTGCTCTCTCTGAGCC 0: 1
1: 0
2: 5
3: 35
4: 440
Right 1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG 0: 1
1: 1
2: 17
3: 140
4: 816
1152123524_1152123532 9 Left 1152123524 17:78433081-78433103 CCAGGGTCCATGTCGCTATTGAT 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG 0: 1
1: 1
2: 17
3: 140
4: 816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152123532 Original CRISPR GAGAGTGAGGAGGAGGACCC AGG Intronic
900083488 1:875912-875934 GAGAGTGTGGGGGAGGAGCGTGG - Intergenic
900083507 1:875965-875987 GAGAGTGTGGGGGAGGAGCGTGG - Intergenic
900113700 1:1019984-1020006 GAGGGGGAGGAGGAGGGCGCGGG + Intergenic
900534744 1:3171293-3171315 GACAGCGAGGAGGAGGAACAAGG - Intronic
900596623 1:3482948-3482970 GAGAGTGAGCAAGAAGACCCCGG - Intergenic
901456548 1:9366314-9366336 GACAGTGAGGCTGAGGGCCCAGG - Intronic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
902161049 1:14530608-14530630 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
902292316 1:15443375-15443397 GTGAGTGGGCAGGAGGGCCCTGG - Intronic
902313847 1:15602906-15602928 GAGACTGAGGCAGAGAACCCGGG + Intergenic
902410060 1:16207132-16207154 CAGCGCGAGGAGGAGGGCCCGGG - Exonic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902811158 1:18888815-18888837 GTGACTGAGGGGGAGGACCCAGG - Intronic
902919708 1:19658451-19658473 GTCAGTGAGGAGGAGAACACAGG - Intronic
902961569 1:19967053-19967075 GAGAAGGAGGAGGAGGAAACAGG - Intergenic
903033144 1:20477521-20477543 TGAAGGGAGGAGGAGGACCCAGG - Intergenic
903167647 1:21532007-21532029 GATGTTGAGAAGGAGGACCCAGG + Intronic
903742804 1:25567998-25568020 TAGAGTGAAGAGTAGAACCCAGG + Exonic
903751489 1:25624203-25624225 GGGAGTGAGGAGGAAGACGGAGG - Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903846942 1:26284361-26284383 GACAGGGTGGAGGAGCACCCAGG - Exonic
903907206 1:26695942-26695964 GAGCGGGGGGAGGGGGACCCGGG - Intergenic
904003101 1:27349676-27349698 GAGAATGGGGAGGAGGCCCCGGG + Exonic
904045519 1:27606037-27606059 GAGAGAAAGGAGGAGGAACCTGG - Intergenic
904267784 1:29327422-29327444 GAGAGGGAGGAGGAGCAGGCTGG + Intergenic
904482075 1:30800420-30800442 CAGAGTGAGGAGGAAGGCCTAGG + Intergenic
904485886 1:30824386-30824408 GAGAGAGAGGAGAAGGACAGAGG + Intergenic
904602691 1:31682596-31682618 GAGGGTGAGGAGGCAGAGCCAGG - Intronic
904833529 1:33320610-33320632 GAGAGTGGGGAGCAGGGCACAGG - Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905088845 1:35410104-35410126 GAGAGTGAGGACGAAGTACCAGG + Intronic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905288978 1:36908385-36908407 GAGAGGGAGCAGGAGGACCCAGG - Intronic
905309719 1:37041036-37041058 GACACTCAGGAGGAGGAGCCAGG + Intergenic
905349057 1:37331895-37331917 GAGGGTGAGGAGGAGGAGAGTGG - Intergenic
905390758 1:37634286-37634308 GCGAGTGAGGATGATCACCCGGG + Intronic
905407061 1:37740986-37741008 GAGAGGCAGGAGGAAGACCAAGG + Intronic
905540109 1:38753919-38753941 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
906962257 1:50425821-50425843 GAGTGGGAGGAGGAGCATCCTGG + Intergenic
907112114 1:51935723-51935745 GAGAGAGAAGAGGAGGAGCAGGG + Intronic
908473798 1:64470048-64470070 GAGAGAGAGGAGGGGCAACCGGG + Intergenic
908648604 1:66307390-66307412 GAGACAGAGGAGCAGGAACCAGG + Intronic
909716779 1:78717876-78717898 GAGAGAGGGGAGGAGGTGCCAGG + Intergenic
909976932 1:82056743-82056765 GAAAGTGAGGAGAAGGACAATGG - Intergenic
910576348 1:88768953-88768975 GAGAGAGAGGAGGAAGTGCCAGG + Intronic
910724375 1:90323244-90323266 GACAGAGAGGAGGAGGTGCCAGG + Intergenic
912385280 1:109268374-109268396 GAGAATGAGGAGGAGGGCTTAGG + Intronic
912440181 1:109691742-109691764 GTGAGTGAGGGGCAGGCCCCGGG - Intronic
912443500 1:109716119-109716141 GTGAGTGAGGGGCAGGCCCCAGG - Intronic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913103999 1:115595211-115595233 GGGAGTGAAGAGGAAGACCTGGG - Intergenic
914413426 1:147454882-147454904 GAGAGAGAGGAGGAGATGCCAGG + Intergenic
915029781 1:152868234-152868256 GTGAGTGCTGAGGAGGACCCAGG + Intergenic
915113119 1:153577426-153577448 TAGAGAGAGGAAGAGGACCTGGG - Intergenic
915311685 1:155008499-155008521 AAGAGGGAGGAGGGGAACCCTGG - Intronic
915347184 1:155203462-155203484 GGGAGCGGGGAGGAGGCCCCAGG - Intronic
915366967 1:155322071-155322093 CTGAGTGAGGAGGAGCAGCCTGG - Exonic
915474768 1:156147112-156147134 AAAAGTGAGGCAGAGGACCCTGG + Intergenic
915557903 1:156670313-156670335 GAGAGCGAGGAGGATGAGCTCGG - Exonic
915713801 1:157925538-157925560 GAGGGTGAGAAGGTGGACGCGGG + Intergenic
915758764 1:158289889-158289911 GAGATTGAGTAGGAGGACCAAGG + Exonic
916400896 1:164447706-164447728 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
916443965 1:164854917-164854939 GAGAGAGAGGAGGATAACTCTGG - Intronic
916675529 1:167061993-167062015 GGGGGTGGGGATGAGGACCCGGG - Intronic
917498871 1:175567648-175567670 GGGAGTGAGAAGGAGGAACCTGG + Intronic
917534264 1:175863215-175863237 GGGAATGAGGAAGAGGACCAGGG - Intergenic
917806762 1:178620837-178620859 GAGAGAGAGGATGAGGCACCAGG + Intergenic
918216969 1:182400246-182400268 AAGAGTGAGGAGGATGAACATGG + Exonic
918558692 1:185838027-185838049 GAGACTGAGAGGGAGGTCCCTGG + Intronic
919834770 1:201566092-201566114 CAGAGTGTGGGGGAGGCCCCTGG - Intergenic
921040080 1:211422656-211422678 GAGAGAGAGGAAGAGGTACCAGG + Intergenic
921076219 1:211702197-211702219 GTGAGTGAGGAGGAGGTGTCTGG + Intergenic
921176455 1:212599541-212599563 GAGAGGGAGGAAGAAGAGCCAGG - Intronic
921231865 1:213081350-213081372 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
921398388 1:214693315-214693337 GAGAGAGAAGAGGAGGTACCAGG - Intergenic
921448455 1:215274155-215274177 GAGAGTGAGAAGGACGAGTCTGG - Intergenic
921960388 1:221027801-221027823 GATAGAGAGGAGGAGGTGCCAGG - Intergenic
921999190 1:221457296-221457318 GAGGGAGAAGAGGAGGTCCCTGG + Intergenic
922214164 1:223507161-223507183 AAGAGAGAGGAGCAGGACACAGG - Intergenic
922315021 1:224434543-224434565 GAGGGGGAGAAGGAGGATCCGGG + Intronic
922435368 1:225599980-225600002 GAGAGAGAAGAGGAGGACCCAGG - Intronic
922812964 1:228428271-228428293 AAGAGAGAGGAGGAGGTGCCGGG + Intergenic
923021845 1:230170768-230170790 GAGAGAGGGGAGGAGGTGCCAGG + Intronic
923036623 1:230288986-230289008 GAGTGTCGGAAGGAGGACCCAGG - Intergenic
923052179 1:230396484-230396506 GGGTGAGTGGAGGAGGACCCTGG - Intronic
923187240 1:231586152-231586174 GAGAGTCAGGTTGAGAACCCAGG + Intronic
923417065 1:233773309-233773331 AAGAGGGAGGAGGAGGTGCCAGG + Intergenic
923801544 1:237214474-237214496 GGAAATGAGGAGGAGGTCCCAGG + Intronic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924384118 1:243487217-243487239 GGGAGAGAGGAGGACGTCCCGGG - Intronic
924455470 1:244215562-244215584 GAGGCGGAGGAGGAGGAGCCGGG + Intergenic
924458415 1:244236830-244236852 GGGACTGAGGATGAGGACACCGG + Intergenic
1063373576 10:5538068-5538090 GAGAAGGAGGAGGAGGACAAAGG - Intergenic
1063541098 10:6934634-6934656 GAGAGGGAAGAGGAGGTGCCAGG - Intergenic
1063555462 10:7074986-7075008 GAGAGTGATGGGAAGGACCCAGG - Intergenic
1064292987 10:14052533-14052555 GAGAGTGGGGAGGAGGTGCCAGG + Intronic
1064864030 10:19859052-19859074 GGGAGAGAGGAGGAGGTGCCAGG + Intronic
1064947923 10:20812844-20812866 GAGAGTGAGGAAGAACACCCAGG - Exonic
1064978941 10:21147222-21147244 GAGAGGCAGGAGGAGGTCCCAGG - Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1065343065 10:24723947-24723969 GAGTGGGAGGAGGTGGATCCAGG - Intergenic
1065360491 10:24884899-24884921 GACATGGAGGAGAAGGACCCAGG + Intronic
1065534964 10:26707662-26707684 GAGAGAGAGGAGGGGGCCCACGG - Intronic
1065991171 10:31011920-31011942 GTGAGTGAGGAGGAGGACAGTGG - Intronic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1066232183 10:33446917-33446939 GATGGTGAAGAGAAGGACCCGGG - Intergenic
1066298417 10:34075949-34075971 GAGAGTCAGAAGGAGGTCCTGGG + Intergenic
1066703805 10:38156817-38156839 GAGGGTGAGGAGGAGGTCGGGGG + Intergenic
1067901659 10:50247987-50248009 TGGAGTGAGGAGGTGGACCAAGG - Intronic
1067972862 10:50991893-50991915 GGGGGTGGGGAGGAGGACCGCGG + Intronic
1068041042 10:51824734-51824756 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1068316522 10:55350994-55351016 GAGAGGGAGGGGGAGGAGACAGG - Intronic
1068740686 10:60466052-60466074 GAGAGTGAGTGGCAGGACCATGG - Intronic
1069789358 10:71009876-71009898 CAAAGTGGGGAGCAGGACCCGGG + Intergenic
1069797912 10:71064990-71065012 GAGGCTGAGGAGGAGGCTCCAGG - Intergenic
1069898201 10:71691904-71691926 AAGACTGAGGAAGGGGACCCAGG + Intronic
1070555923 10:77527732-77527754 GGGAGTGAGGAGGAGGCACAAGG + Intronic
1070656802 10:78277252-78277274 GAGAGGGAGGAGCAGCACACTGG - Intergenic
1070723653 10:78773552-78773574 GAGAGTGAGGGAGGAGACCCAGG - Intergenic
1070795498 10:79214099-79214121 GAGAGTGAGGAGGAAGATTCTGG - Intronic
1071008319 10:80909463-80909485 GGGAGTGAGGGGGAGGTGCCAGG + Intergenic
1071277438 10:84068614-84068636 GAGAGTGAGGAGGAGGTATCAGG - Intergenic
1071294178 10:84207250-84207272 GAGAGTGAGGAGGAGGAGAGGGG + Intronic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072273625 10:93801410-93801432 AAGACTGAGGAGGAGGACACGGG + Intergenic
1072436058 10:95415648-95415670 GAGGGTCAGGAGGAGGAGCAGGG + Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1073067999 10:100775235-100775257 GAGAAAGAGGAGGAGGAACATGG + Intronic
1073340916 10:102743993-102744015 GAGAGGGAGGAGGAGGAGGGAGG + Exonic
1073502151 10:103949937-103949959 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1074604994 10:114953821-114953843 GAGAGAGAGGCGGAGGTGCCAGG + Intronic
1075001560 10:118802491-118802513 AAGAGTGGGGAGGAGGACAGAGG + Intergenic
1075166422 10:120071951-120071973 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075620032 10:123919905-123919927 GAGAGAGAGGAGGAGGTTCCAGG + Intronic
1075625195 10:123959094-123959116 GAGACTGAGGAGAGGGACCTTGG - Intergenic
1075674427 10:124286513-124286535 GAGAGGGAGGAGGAGCCCCTGGG + Intergenic
1075709934 10:124525562-124525584 GAGAGTGGGGAGGAGACCCGAGG + Intronic
1076135872 10:128045519-128045541 GAGAGGGAGGAGGGGGACCGAGG + Intronic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1076880530 10:133237325-133237347 GAAAGAGACGCGGAGGACCCGGG - Intergenic
1077065095 11:637537-637559 GAGAGCGAGGAGGAGGTCGGCGG - Exonic
1077197939 11:1290743-1290765 GGGAAAGAGGAGGAGGTCCCGGG + Intronic
1078050574 11:7961995-7962017 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1078082059 11:8211302-8211324 GAGAATGACAAGGAGGACACAGG + Intergenic
1078349802 11:10583253-10583275 GAAAGACAAGAGGAGGACCCAGG + Intronic
1078723530 11:13906270-13906292 GAGAGAGGGGAGGAGGTGCCAGG + Intergenic
1079135716 11:17775074-17775096 GAGAGTGAGGGGGAGGCCAGGGG + Intronic
1079202443 11:18387213-18387235 GCGGGTGAGGAGGAGGAGACAGG + Intergenic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1080778040 11:35404392-35404414 AAGGATGAGGACGAGGACCCAGG + Intronic
1082274358 11:50205824-50205846 GAGAGAGAGGAGGAGGTTCCAGG - Intergenic
1082796471 11:57381486-57381508 GAGAGTGAAGTGGAGATCCCAGG + Intergenic
1082862563 11:57869856-57869878 GAGAATGGGGAGGAGGTGCCAGG + Intergenic
1083147701 11:60771350-60771372 GAGTGTGAACAGGGGGACCCAGG + Intronic
1083268375 11:61557781-61557803 GAGAGGGAGGGGCAGGACCTTGG - Intronic
1083543799 11:63534330-63534352 GACAGTGAGAAGGATGAACCCGG + Intergenic
1083727818 11:64637526-64637548 TGGAGTGGGGAGGAGGACCCTGG - Intronic
1083757974 11:64801660-64801682 GGGAGGGAGGAGGAGGCCCTCGG - Intronic
1083898115 11:65630389-65630411 GAGGGTGTGGAGGAGGACGAGGG + Exonic
1084009135 11:66338066-66338088 GAGTTTGAGGAGCAGGAACCAGG - Intronic
1084163845 11:67365958-67365980 GACAGAGAGGAAGAGGAGCCTGG + Intronic
1084548421 11:69826024-69826046 GGGAGCCGGGAGGAGGACCCTGG - Intergenic
1084942894 11:72623344-72623366 GAGACAGAGGAGGAGGGCCAGGG - Intronic
1085060958 11:73446603-73446625 GTGAGGGAGGAGGAGGAATCTGG - Intronic
1085151378 11:74255058-74255080 GAGAGACAGGAGGAGGAACCTGG - Intronic
1085290538 11:75396077-75396099 GAAAGTGAGGAGGAGGTTCTGGG + Intergenic
1085393633 11:76195065-76195087 GAGTGTGAGTAGGAGGACGTGGG - Intronic
1085728992 11:78980388-78980410 GAGAGCCAGGAGGTGGCCCCAGG + Intronic
1086528047 11:87752298-87752320 GCGGGTGAGGAGGAGGATACTGG + Intergenic
1086807978 11:91268757-91268779 GAGAGTCAGGAGCAGGAATCGGG + Intergenic
1087219514 11:95531245-95531267 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1087280541 11:96204755-96204777 GAGAGAGAGGACAAGGACTCAGG + Intronic
1088533724 11:110837713-110837735 GAGAGTGAGGGGGAGGTACATGG + Intergenic
1088923388 11:114278238-114278260 GAGAGAGAGGAGGAGATGCCAGG + Intronic
1089058787 11:115608996-115609018 CAGAATGAGGAGGAGGGCACAGG - Intergenic
1089179965 11:116576709-116576731 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1089590681 11:119538619-119538641 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
1089781626 11:120877092-120877114 GAGAGTCAGCAGCAGGACTCTGG - Intronic
1090279197 11:125441679-125441701 GAGAGTGAGAAGCAGGACACAGG + Intergenic
1091294090 11:134460357-134460379 GAGAGTGATGAGAATGAGCCGGG - Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091797688 12:3306531-3306553 GAGAGGGAGGGAGAGGAACCAGG + Intergenic
1091871370 12:3893944-3893966 GAGAGAGAGTAGGAGGGCCTGGG - Intergenic
1092446733 12:8564776-8564798 GAGGTGGAGGAGGAGGAGCCGGG + Intergenic
1092701271 12:11233704-11233726 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1093070708 12:14705221-14705243 GAGAGAGAGGATGAGGTGCCAGG + Intergenic
1094167801 12:27460573-27460595 TAGACTGAGGAGGAGAAGCCGGG + Intergenic
1094480653 12:30878885-30878907 GAGGGTGAGGAAGAGGAGCTGGG - Intergenic
1094485474 12:30923239-30923261 GAGAGTGTGGAGGAGGTGCCAGG + Intergenic
1095728915 12:45483640-45483662 GAGAGAGAGAAGGAGGTGCCAGG + Intergenic
1096194836 12:49643132-49643154 TCGAGAGAGGAGGAGGACCCAGG - Exonic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096590284 12:52654112-52654134 GAGAGTGGGGAGGGAGACCAGGG - Intergenic
1096694283 12:53338924-53338946 GAGACTGGGGAGCTGGACCCAGG - Intronic
1097182137 12:57177666-57177688 GAGGGTGATGAGAAGGACCAAGG + Intronic
1097874822 12:64633440-64633462 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1098268427 12:68746601-68746623 GAGGGCCAGGAGGAGGAGCCTGG - Exonic
1099435827 12:82643895-82643917 GAGAGAGAAGAGGAGGTGCCAGG + Intergenic
1099681652 12:85836915-85836937 GAGAGTGTGGAGCAGGGGCCTGG - Intergenic
1099982938 12:89628055-89628077 GAGAGGGAGGAGGAAGAGCAGGG + Intronic
1101688528 12:107050488-107050510 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1102289439 12:111686775-111686797 CAGGGTGGGGAGGAGGACCCCGG - Intronic
1102304256 12:111792545-111792567 GACAGTGAGGAGGAGGACCCTGG - Intronic
1102389684 12:112539548-112539570 CAGAGTCAGGAGCAGAACCCAGG - Intergenic
1102455025 12:113065771-113065793 GAGGGTGACGAGGAGGGGCCAGG + Intronic
1102464660 12:113121450-113121472 GAGAATGAGCAGGAGTCCCCTGG - Intronic
1102561551 12:113766143-113766165 GAGAGTGAGGAGGCGCCCTCGGG + Intergenic
1102568905 12:113815449-113815471 GAGAGTGAGGGGGACAGCCCGGG - Intergenic
1102591393 12:113959226-113959248 GAGAGTGAGGAGGAGGGAGCCGG - Exonic
1102764855 12:115423515-115423537 GGGAGGGAGGAGGAGGACAAAGG - Intergenic
1102928060 12:116841976-116841998 GAGAGAGAGAGGGAGGATCCAGG + Intronic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103598461 12:122038712-122038734 GAGAGTTAGGATGTGAACCCAGG - Intronic
1103736142 12:123062032-123062054 GAGAAGGAGGAGGAGGAGCAGGG - Intronic
1103826702 12:123744846-123744868 CAGAGTGAGGAGGCTGACCTGGG - Intronic
1104168967 12:126261312-126261334 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
1104409142 12:128543634-128543656 CTGAGTGAGGAGACGGACCCAGG + Intronic
1104523263 12:129495300-129495322 CAGAGTGAGGAGGAAGACCTCGG - Intronic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1104819068 12:131664515-131664537 GAGGCAGAGGAGGAGGAGCCAGG - Intergenic
1105249122 13:18680618-18680640 GAGGAGGAGGAGGAGGACGCGGG + Intergenic
1105431710 13:20343171-20343193 GAGAGTGAGGAGGACGGACAGGG - Intergenic
1106214498 13:27683517-27683539 GAGAGTGAAGATGAGGACATTGG - Intergenic
1106522635 13:30511391-30511413 GAGAGAGATGAGGAGGTGCCAGG - Intronic
1108207558 13:48106305-48106327 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1108288954 13:48938241-48938263 GATAGTGAGTAGTAGGACCAGGG + Intergenic
1108392846 13:49964645-49964667 GAGAGAGGGGAGGAGGTGCCGGG - Intergenic
1108605112 13:52029825-52029847 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1108713645 13:53057974-53057996 GACAGTGCAGAGGGGGACCCTGG + Intergenic
1108770370 13:53693481-53693503 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110401826 13:75100938-75100960 GAGAGAGAGGAGGGGGTTCCAGG + Intergenic
1111179976 13:84651568-84651590 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1111759447 13:92443162-92443184 GAGAGAGGGGAGGAAGTCCCAGG + Intronic
1112585051 13:100711717-100711739 GAGAGAGAGGAGGAGGAAGAGGG - Intergenic
1113069162 13:106402838-106402860 GAGAATGAGGAGGAGGAGATAGG - Intergenic
1113353053 13:109548489-109548511 GAGGGTCAGGAGGAGGACAGAGG - Intergenic
1113596394 13:111537143-111537165 GAGAAGGAGGAGGATGACCGAGG - Intergenic
1113635007 13:111913390-111913412 GAGAGGGAGGAGGAGAAGCCTGG - Intergenic
1114400409 14:22405135-22405157 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1114715726 14:24821945-24821967 GAGAGTGAGGGAAAGAACCCTGG - Intronic
1114865952 14:26596951-26596973 GAGGAGGAGGAGGATGACCCCGG - Intronic
1114873865 14:26691082-26691104 GAGAGGGAGGAGAAGGACACAGG - Intergenic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115500767 14:34047547-34047569 GAGAGAGAGGAGAAGGTGCCAGG + Intronic
1115903650 14:38183185-38183207 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1116002030 14:39254113-39254135 GAGGGTGGGGAGAAGGAGCCTGG + Intronic
1116975350 14:51109799-51109821 GAGACAGGGGAGGAGGAGCCAGG + Intergenic
1116979819 14:51156643-51156665 GAGAGTGAGGAGGAGTTTCCAGG - Intergenic
1117141157 14:52791832-52791854 GGGAGCGAGGAGGAGGAGCCGGG - Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117338974 14:54777699-54777721 GTCAGGGAGGAGGAGGACGCTGG + Intronic
1118084966 14:62404181-62404203 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1118534864 14:66750530-66750552 GTGAGGGAGGAGGATGACCTTGG + Intronic
1118891756 14:69915860-69915882 GAGAGAGATGAGGGGGAGCCAGG - Intronic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1119548899 14:75493664-75493686 GAGAGTGGGGAGGGGGACTGGGG + Intergenic
1120461315 14:84799977-84799999 GAGAGTGAAGTGGAGAAGCCAGG + Intergenic
1120715938 14:87840760-87840782 GAGAGAGAAGAGGAGGTGCCAGG + Intronic
1120964596 14:90156291-90156313 GAGAGTGGAGAAGAGGCCCCAGG + Intronic
1121024921 14:90608600-90608622 GAGGGGGAGGAGGAAGACCCGGG + Intronic
1121248667 14:92483438-92483460 CAGAGTTAGGATTAGGACCCAGG + Intronic
1121358219 14:93232378-93232400 GAGGGTGAGGAGGCGGAGCCAGG - Intergenic
1121533834 14:94677562-94677584 GAGAGGCAGGAGGAGGAAGCAGG + Intergenic
1122302139 14:100737168-100737190 GAGATTGGGGTGGAGGACCCAGG - Exonic
1122351715 14:101098838-101098860 AACAGTGAGGAAGAGGCCCCAGG - Intergenic
1122903599 14:104792072-104792094 ATGAGTGAGGAGGGGGACACAGG + Intronic
1123049975 14:105536523-105536545 GTGAGTGAGGAGGTGGTCCCTGG - Intergenic
1123067687 14:105626733-105626755 GAGGCTGAGGAGGAGGCTCCAGG - Intergenic
1123071706 14:105645458-105645480 GAGGCTGAGGAGGAGGCTCCAGG - Intergenic
1123091370 14:105743734-105743756 GAGGCTGAGGAGGAGGCTCCAGG - Intergenic
1123097141 14:105772075-105772097 GAGGCTGAGGAGGAGGCTCCCGG - Intergenic
1123111405 14:105868727-105868749 GAGAGTGAGGAGAAGGTCTGAGG + Intergenic
1124168581 15:27352295-27352317 TAGTGAGAGGAAGAGGACCCAGG + Intronic
1124177241 15:27437900-27437922 AAGAGAGAGGAGGAGGTTCCAGG + Intronic
1124716840 15:32071664-32071686 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1126731804 15:51691230-51691252 GAGACTGGGGAGGTGGACCCAGG + Intronic
1127225086 15:56919263-56919285 GAGCCTGGGGAGGAGGACGCCGG + Intronic
1127267443 15:57373708-57373730 GAGAGTGAGGACCAGGAGCCAGG - Intergenic
1127280406 15:57486061-57486083 GTGAGTCAGGAGCAGGGCCCGGG + Intronic
1127692821 15:61414591-61414613 GGCAGGTAGGAGGAGGACCCAGG - Intergenic
1127918089 15:63471908-63471930 GAAAGTGAGGAGGACGAGCCAGG + Intergenic
1128217042 15:65941812-65941834 GGGAGTGGGGAGCAGGACCCTGG + Intronic
1128427335 15:67555279-67555301 GAGAGAGTGGAGGAGGTGCCAGG + Intronic
1128467458 15:67924903-67924925 GAGAGAGAGAAGGAGGTGCCAGG + Intergenic
1128610715 15:69070993-69071015 GAGAGGGAGGAAGAGGTGCCAGG + Intergenic
1128675075 15:69602591-69602613 GAGAGGGTGGAGGGGGTCCCGGG - Intergenic
1128750595 15:70146271-70146293 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1128765462 15:70248502-70248524 GGCAGTGAGGAGGAGGACAAAGG - Intergenic
1128842886 15:70864395-70864417 GAGAGGGAAGAGCAGGGCCCTGG + Intronic
1128896154 15:71375840-71375862 GAGGCTCTGGAGGAGGACCCTGG + Intronic
1129012654 15:72436726-72436748 GTGAGAGAGGAGGAGGAGCCAGG - Intergenic
1129019933 15:72507472-72507494 GGGAGTGAGGAAGAGGACTGAGG - Intronic
1129094813 15:73194508-73194530 GTGAGAGAGGAGGAGGTTCCAGG + Intronic
1129260990 15:74367264-74367286 GACAGGGAGGAGGAGGGGCCTGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129413611 15:75362756-75362778 GGGAGTGAGGTGGAGGACAGAGG + Intronic
1129692030 15:77719158-77719180 GGCAGTGAGGAGGACGTCCCAGG - Intronic
1129910018 15:79219462-79219484 GAGAGGGAGGGAGAGGAACCGGG - Intergenic
1130031884 15:80322963-80322985 CAGAGTGGGGTGGAGGACCAGGG - Intergenic
1130319982 15:82833498-82833520 GACAGTGATGAGCAGGACCCTGG + Exonic
1130324681 15:82870372-82870394 GAGAGGGAGGAGGAAGAGGCTGG - Intronic
1130349130 15:83075080-83075102 GAGAGAGGGGAGGAGGTGCCAGG + Intergenic
1130436080 15:83901303-83901325 GAGAGGGAGGAGTAAGACCCAGG + Intronic
1130656227 15:85793869-85793891 GTGGGTGAGGGGGCGGACCCAGG - Intronic
1130747203 15:86668036-86668058 GAGAGAGAGGAGCAGGTGCCAGG + Intronic
1130996418 15:88906991-88907013 GTGAGGGGGGAGGAGGCCCCAGG - Intronic
1131025321 15:89136612-89136634 GAGAGTGAGGAGGCTGCACCTGG - Intronic
1131147637 15:90024488-90024510 GAAAGAGAGGAGGAAGACCCCGG + Intronic
1131272095 15:90953709-90953731 GAGAGTGAGGGGGTTGTCCCTGG + Exonic
1131373473 15:91903963-91903985 GAGAGTGAAGAGGAGGAAACAGG + Intronic
1132163608 15:99565253-99565275 GGGAGGGAGGAGGCTGACCCGGG + Intergenic
1132729849 16:1355966-1355988 GAGGGTGAGGGTGAGGTCCCCGG + Intronic
1132974616 16:2705132-2705154 CAGAGTGACGACGAGGACCAGGG + Intronic
1133009127 16:2900630-2900652 GGGAGTGAGGAAGAGGAGGCCGG + Intergenic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133337285 16:5014509-5014531 AAGAGCTAGGAGGAGGACCATGG + Intronic
1133535838 16:6701592-6701614 GTGAGAGAGGAGGAGGTGCCAGG + Intronic
1133598275 16:7313850-7313872 CACAGTGAGGAGGAGGACATAGG - Intronic
1134186586 16:12089662-12089684 GAGAGTGAGTTGGAGGATGCTGG + Intronic
1134208795 16:12259046-12259068 GAGAGAGAGGAGGGGGAATCTGG - Intronic
1134302151 16:13001313-13001335 GAGAGGGAGGAGCAGGTCCCCGG - Intronic
1134449499 16:14354447-14354469 GAGAGGGAGGAGGAGGGGCGGGG + Intergenic
1134449525 16:14354513-14354535 GAGAGGGAGGAGGAGGAGAGAGG + Intergenic
1134535666 16:15024840-15024862 AAGAGTGATGAAGACGACCCAGG - Intronic
1134594206 16:15482474-15482496 GAGACTTTGGAGGAGGAGCCTGG + Intronic
1134741490 16:16551054-16551076 GAGAGAGAGGAGGAGATGCCAGG + Intergenic
1134926068 16:18161376-18161398 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
1135129492 16:19840761-19840783 GAGAGAGAGAGGGAGGACTCTGG - Intronic
1135611916 16:23875377-23875399 AAGACTGAGGAGGAAGACCCAGG + Intronic
1135684719 16:24489619-24489641 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
1135933846 16:26762343-26762365 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1136412446 16:30085232-30085254 GGGAGAGAGGAGGAGGAACATGG - Exonic
1136540759 16:30926577-30926599 CAGAGTGGGGAGGGGGACGCAGG - Intronic
1136548011 16:30966153-30966175 GAGACTGAGGAGGAGGGCAGGGG - Exonic
1137265165 16:46862862-46862884 AAGAGAGAGGAGGAGGCACCAGG + Intergenic
1137540305 16:49357130-49357152 GAGAGAGTGAAAGAGGACCCTGG - Intergenic
1137576193 16:49601889-49601911 GAGGGAGAAGAGGAGGACTCAGG - Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137847788 16:51709083-51709105 GTGAGGGAGGAGGAGGAGTCGGG + Intergenic
1138105433 16:54285159-54285181 GGGGGGGAGGAGGAGGACACGGG - Exonic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138421605 16:56902761-56902783 GAGGAGGAGGAGGAGGACTCCGG - Intronic
1138456674 16:57125091-57125113 GAGGGTTAGAAGTAGGACCCCGG - Intronic
1138554659 16:57764484-57764506 GAGAGAGAGCAGGAGGAGCTGGG - Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139386832 16:66578439-66578461 TAAGGGGAGGAGGAGGACCCAGG - Intronic
1139421247 16:66850757-66850779 GAGGGGGAAGAGGAGCACCCGGG + Intronic
1139477714 16:67210981-67211003 GAGAGGGAGGCAGAGGACACGGG + Exonic
1139860378 16:70015938-70015960 AAGAGTGATGAAGACGACCCAGG + Intergenic
1140295368 16:73704721-73704743 GAGAGTGAGCCAGAGGAGCCGGG + Intergenic
1140528836 16:75647314-75647336 GAGACTGTGGAGGAGGAACTAGG - Intronic
1140661550 16:77194559-77194581 GACAGTATGGAGCAGGACCCAGG + Exonic
1141192290 16:81833422-81833444 GTGGGTGAGGAGGAGGCACCTGG + Intronic
1141578930 16:84983897-84983919 GAGGGTGAGGCAGAGCACCCGGG + Intronic
1141778458 16:86140482-86140504 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1142234575 16:88915626-88915648 GGGAGTGTGGAGGAGGAGCGTGG + Intronic
1142658987 17:1414595-1414617 GAGAGTGAGGAAGATGAGGCTGG + Intergenic
1142745000 17:1951928-1951950 GTGAGTGAGGTGGGGGAGCCAGG + Intronic
1142852155 17:2709510-2709532 GAGGGGGAGGAGGAGGAGGCTGG - Intronic
1142986878 17:3700809-3700831 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143355096 17:6321757-6321779 GAGAGGGAGGAGGAGGCTCTTGG - Intergenic
1143363123 17:6387533-6387555 GAGAGAGAGGAGGAAGAAACAGG + Intergenic
1143614682 17:8042736-8042758 GGGAGTGGGGAGGAGGCCCTGGG - Intronic
1143779588 17:9222229-9222251 TGGAGTGAGGAGGAGGACGGAGG - Intronic
1143789448 17:9281992-9282014 GAGAGTGGGGAGAAGGCCCCAGG - Intronic
1144179579 17:12739423-12739445 GAGAGTTACACGGAGGACCCAGG + Intronic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144218966 17:13082920-13082942 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1144646847 17:16980980-16981002 GAGAGTCTGGACGAGGCCCCAGG + Intergenic
1144676451 17:17165381-17165403 GAGGATGAGGACGAGGACCTGGG + Intronic
1144712273 17:17409639-17409661 GGGAGGGAGGAAGAGTACCCTGG - Intergenic
1144751688 17:17653238-17653260 GAGAGAGAGGTGGAGGTGCCAGG + Intergenic
1146208943 17:30926959-30926981 GAGGGGGAGGAGGTGGAACCAGG - Intronic
1146631671 17:34474416-34474438 CAGAGAGAGGAGCGGGACCCAGG + Intergenic
1146661006 17:34665212-34665234 GACAGAGAGGAGGAGGTGCCAGG + Intergenic
1147119941 17:38330013-38330035 CAGAGGCAGGAGGATGACCCAGG - Exonic
1147500095 17:40954830-40954852 GAGAGTGAGGAGCAGAAGACGGG + Intergenic
1147725555 17:42564331-42564353 GAGTCGGAGGAGGAGGAGCCTGG + Intronic
1147755135 17:42762552-42762574 GTGAGAGAGGGGGTGGACCCAGG - Intronic
1148521057 17:48275339-48275361 CAGAGGTAGGAGGAGAACCCAGG - Intronic
1148752321 17:49952342-49952364 GTGGGTGACTAGGAGGACCCAGG - Intergenic
1148763970 17:50026880-50026902 GAGAGGCAGGAGGAGGAACAGGG + Intergenic
1148778642 17:50109749-50109771 GAGAGGGAGGGGGAGGAGGCTGG - Intronic
1148899399 17:50865527-50865549 GAGAAGGAGGAGGAAGGCCCGGG + Intronic
1149406479 17:56357047-56357069 GAGAATGAGGAGGAAAACCAGGG - Intronic
1149485827 17:57042074-57042096 GAAAATGAGGAGGAGGAATCCGG + Intergenic
1149585659 17:57784510-57784532 GAGAGGTAGGAGGAGAACCAGGG - Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149866934 17:60156366-60156388 GAGGAGGAGGAGGAGGGCCCAGG + Intronic
1149867909 17:60160948-60160970 GAGAGTGAGGTGGAGGGCATTGG + Intronic
1149882304 17:60305323-60305345 GAGAGAGAGGAGGAAGTACCAGG + Intronic
1149983452 17:61329741-61329763 GAGGGTGAGGAGGAGGAAAAGGG + Intronic
1150495797 17:65607050-65607072 GAGAGTGATGAGGAAGAGTCTGG + Intronic
1151077937 17:71295900-71295922 GAGAGAGAGGAGGAGGTGCCTGG + Intergenic
1151218031 17:72591295-72591317 GAGAAGGAAAAGGAGGACCCTGG + Intergenic
1151335832 17:73439135-73439157 GAGAGAGGGGAGGAGGAGCTAGG - Intronic
1151433990 17:74082885-74082907 GAGGGTGAGGAAGAAGACCCAGG + Intergenic
1151657363 17:75502270-75502292 GACACGGAGGAGGAGGAGCCAGG - Exonic
1151694189 17:75705690-75705712 GGGTGTGAGGAGGAGGGGCCTGG + Intronic
1151812503 17:76452852-76452874 GAGGGCGAGGAGGAGGGCCGCGG - Exonic
1151869693 17:76827898-76827920 GAGAGTGAGTAAGAAGACACTGG - Intergenic
1151886678 17:76926803-76926825 GAGAGGGAGGAGCGAGACCCTGG - Intronic
1151933718 17:77248652-77248674 GAGAGAGAGGAGGTGGACCTGGG - Intergenic
1152042639 17:77914489-77914511 GAGGGGGAGAGGGAGGACCCAGG - Intergenic
1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG + Intronic
1152132451 17:78485372-78485394 GAGACAGAGGAGGAGCAGCCGGG - Intronic
1152217901 17:79045108-79045130 GAGAGGGAGGAGCGGGTCCCAGG + Intronic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1152685118 17:81690106-81690128 GAGAGTGAGGAAGGGGCTCCCGG + Intronic
1152700721 17:81817606-81817628 GTGAGTGCAGGGGAGGACCCGGG - Intergenic
1152768245 17:82152403-82152425 GAGAGGGAGGAGGCCGACACAGG + Intronic
1152781315 17:82228562-82228584 GAGAGGGAGGATGTGGGCCCCGG + Intronic
1152880501 17:82812049-82812071 GGGAGTCAGGAGGGGGCCCCAGG - Intronic
1153366552 18:4263614-4263636 TAAAGTGAGGAGGAGGACATAGG - Intronic
1153688314 18:7567605-7567627 GGGACAGGGGAGGAGGACCCAGG + Exonic
1154031389 18:10756798-10756820 GAGAATGAGGAGGAGGAATGGGG + Intronic
1154439765 18:14378618-14378640 GAGGAGGAGGAGGAGGACGCGGG - Intergenic
1155045246 18:22097556-22097578 GAAACAGAGGAGAAGGACCCCGG - Intronic
1155584904 18:27353626-27353648 GAGAGTCAAGAAGAGGACCTAGG + Intergenic
1155604550 18:27588988-27589010 GAGAGAGAGGGGAAGGTCCCAGG - Intergenic
1156382886 18:36579894-36579916 AAGAGGGAGGAGAAGGACCACGG + Intronic
1156414346 18:36872045-36872067 AAGATAGAGGAGAAGGACCCAGG - Intronic
1157425260 18:47579250-47579272 GAGGGAGAGGAGGAGGAGCTGGG + Intergenic
1157768094 18:50318020-50318042 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1157813693 18:50716334-50716356 GAGAGGGAGGAGGAGACCCAGGG - Intronic
1157978503 18:52353414-52353436 GGGAGGGAGGAGGAGGGCCCAGG - Intronic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158311597 18:56165548-56165570 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1158610508 18:58935491-58935513 GAGAGGGAGGAGGAGGAAGGGGG - Intronic
1159245242 18:65797291-65797313 GAGAGTGAGGTGGAAGAAACAGG - Intronic
1159507389 18:69354772-69354794 GAGAGTAAGGAGGAGTGTCCCGG - Intergenic
1159925526 18:74265764-74265786 GCGAGAGAGGAGGTGGTCCCAGG + Intronic
1160174684 18:76583294-76583316 GTGAGTTAGGAGGATGACCTTGG - Intergenic
1160788571 19:912676-912698 GAGAGTGAGGGGGTGGACCCGGG + Intronic
1160983477 19:1827194-1827216 GAGAGTGAGGACGAGGCCGCAGG - Exonic
1161030670 19:2056461-2056483 CAGAGTGAAGAGGAGGGCCTGGG + Intergenic
1161056926 19:2195351-2195373 GACTGTGAGGAGGAGCACACAGG - Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161142250 19:2654642-2654664 GGGAGAGAGGAGGAGAATCCCGG + Intronic
1161166588 19:2791131-2791153 GAGGGTGAGGAGGACGCCCGAGG - Intronic
1161224304 19:3136111-3136133 GAGGGTGAGGTGGGGGCCCCAGG - Intergenic
1161253100 19:3291753-3291775 GAGAGGGAGGAGGGGGAACATGG + Intronic
1161314005 19:3609403-3609425 GAACGTGAGGAGGAGGAAGCAGG + Intergenic
1161436951 19:4269114-4269136 GAGTCTGATGAGGAGGTCCCAGG + Intergenic
1161663822 19:5563109-5563131 GAGAGGGAGGAGGAGCAAGCAGG + Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162818802 19:13210724-13210746 GAGAGTGAGGAGGTGGTGCATGG + Intronic
1163263943 19:16207167-16207189 GAAAGTGGGGAACAGGACCCAGG + Intronic
1163877603 19:19886609-19886631 AAGTGTGAGGTGAAGGACCCAGG - Intronic
1164441238 19:28282239-28282261 GAGGGTCAGGAGGAAGACCTTGG - Intergenic
1164538701 19:29106199-29106221 GGGAAGGAGGAGGAGGACCAAGG - Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164591899 19:29512016-29512038 GAGAGTGAGGATGAGGATGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164685580 19:30164449-30164471 AAGAGAGAGGAGGAGGTGCCTGG - Intergenic
1164822999 19:31264520-31264542 GATAGGGAGGAGCAGGGCCCAGG + Intergenic
1164841758 19:31398083-31398105 GAGAGAGGGGAGGAGGTACCAGG - Intergenic
1165013102 19:32862991-32863013 GTGAGGGAGGAAGAGGACACTGG + Intronic
1165191376 19:34066599-34066621 GAGAGAGGGGAGGAGGCGCCAGG - Intergenic
1165330917 19:35140907-35140929 GACAGGGAGGAGGAGGACAGGGG - Intronic
1165721402 19:38082097-38082119 GAGTGTGACGCGGAGGACGCGGG + Exonic
1165763559 19:38336464-38336486 CAGAGTGAGGAGCAAGCCCCGGG + Intronic
1166190303 19:41172496-41172518 GAGACTGAGGGTGGGGACCCAGG - Intergenic
1166336541 19:42111706-42111728 GAGGGTGAGGATGGGGATCCTGG - Intronic
1166348173 19:42179544-42179566 GAGGAGGAGGAGGAGGACGCAGG + Intronic
1166352677 19:42207485-42207507 GAGGGAGGGGAGGAGGCCCCTGG - Intronic
1166369428 19:42292883-42292905 CAGAGTGAGTTGGGGGACCCAGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166956637 19:46469604-46469626 GCGGGTGATGAGGAGGACCCTGG - Intronic
1167473475 19:49687702-49687724 GAGAGGGAGGAGGAGTCCTCGGG + Intronic
1167599362 19:50445363-50445385 GAGAGAGAGGAGGAAGTCACAGG - Intronic
1168107312 19:54172850-54172872 GGGTCTGAGGAGGAGGAGCCTGG - Intronic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168417376 19:56177128-56177150 GAGGACGAGGAGGAGGACCAGGG - Exonic
1168613720 19:57821105-57821127 GAGAGAGAGGATGAGGACTTTGG + Intronic
1168617708 19:57851810-57851832 GAGAGAGAGGATGAGGACTTTGG + Intronic
1168726160 19:58583272-58583294 GAGAGGGAGAATGAGCACCCAGG - Intergenic
925200589 2:1965163-1965185 GGCAGGGAAGAGGAGGACCCAGG + Intronic
925200599 2:1965209-1965231 GGCAGGGAAGAGGAGGACCCAGG + Intronic
925200630 2:1965343-1965365 GGCAGGGAAGAGGAGGACCCAGG + Intronic
925461696 2:4068774-4068796 GGGGGTGAGGAGGAGTAGCCTGG + Intergenic
925904774 2:8534042-8534064 GAGGATGAGGAGGGAGACCCAGG + Intergenic
925996751 2:9299695-9299717 GGGAGTGAGAAGCAGAACCCGGG - Intronic
926383543 2:12314523-12314545 GGGAGAGAGGGGAAGGACCCAGG - Intergenic
926385151 2:12328472-12328494 GAGGGAGAGGAGGAGGCGCCAGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926842203 2:17093222-17093244 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
927093727 2:19731793-19731815 GAAAGTGGTGAGGAGGGCCCAGG - Intergenic
928141294 2:28731600-28731622 CAGGTAGAGGAGGAGGACCCAGG + Intergenic
928249576 2:29663437-29663459 GAGAGAGAGAAGGAGGACGATGG - Intronic
928270993 2:29854397-29854419 GAGAGAGAGGGGGAGGTTCCAGG - Intronic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
929087299 2:38181259-38181281 GAGAGAGTGGAGGAGGGACCTGG - Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929587521 2:43125808-43125830 GAGCTAGAGGAGGAGGAGCCAGG - Intergenic
930674836 2:54189317-54189339 GAGGGTGAGGGGGAGGAAACAGG - Intronic
931306403 2:61033649-61033671 GAGTGTCAGGAGGAGGAACAGGG + Intronic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932275854 2:70451794-70451816 GGGAGTGAGGATGAGAACCAGGG - Intronic
933124435 2:78586557-78586579 GGGAGTGAGGAGGAGGATTAAGG + Intergenic
934095506 2:88598940-88598962 GAGAGTGGGCAAGAGGACACGGG + Intronic
934109111 2:88725450-88725472 GAGAGTTAGGAGGAAGGCACAGG - Intronic
934550839 2:95260636-95260658 GGGAGAGAGGATGAGAACCCAGG - Intergenic
934857426 2:97737938-97737960 GGGGATGAGGAGGAGGACACTGG + Intronic
935239266 2:101164252-101164274 GAGAGAGAGGAGGAAGTGCCAGG - Intronic
935557602 2:104527433-104527455 GAGAGTGGGGAGGGGGAAGCTGG - Intergenic
935601372 2:104925493-104925515 GAGGGTGGGGAGGAGGCCACTGG + Intergenic
935661388 2:105469624-105469646 GAGAGTGAGGAGCAGGGGCTGGG + Intergenic
935750009 2:106223581-106223603 GAGAAAGAGGAGGAGGGGCCAGG + Intergenic
936121201 2:109746843-109746865 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
936163516 2:110102010-110102032 GAGAGTGAGAAAGAGGACACTGG - Intronic
936223495 2:110624628-110624650 GAGAGAGAGGAGGAGGTACCAGG + Intergenic
937567926 2:123318658-123318680 GAGAGCGGGGAGGAGGGGCCAGG + Intergenic
938100130 2:128492891-128492913 GTGAGTGAGGAGGAGGAGAGAGG - Intergenic
938137790 2:128773695-128773717 AAGAGAGACGAGGAGGCCCCAGG - Intergenic
939099337 2:137878015-137878037 GAGAGAGAGGGGGAGGTGCCTGG + Intergenic
939139355 2:138335240-138335262 GAGAGTGAAGGGGAAGAGCCAGG - Intergenic
939445266 2:142302070-142302092 GAGAGGGGGTAGGAGGAGCCAGG - Intergenic
939888508 2:147707684-147707706 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
940691643 2:156926356-156926378 GAGAGTGAGGAGGAAGAATGTGG - Intergenic
940726652 2:157342998-157343020 CGGAGTGAGGGTGAGGACCCGGG + Intergenic
941666515 2:168247835-168247857 GGGAGGGAGGAGGAGAACCAGGG - Exonic
942895971 2:181054892-181054914 GAGAGTGAGAACGAGGGGCCAGG + Intronic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
944160200 2:196651947-196651969 AAGAGAGAGGAGGAGGTACCAGG + Intronic
944656541 2:201881470-201881492 GAGGGTGAGGAAGAGGAAACGGG + Intronic
946028331 2:216686052-216686074 GAAAGCCAGGAGGAAGACCCCGG + Intronic
946989218 2:225308996-225309018 GGGACTGAGGAGAAGGACCTTGG + Intergenic
947183205 2:227431201-227431223 GAGAGAGAGGAGAAGGTTCCAGG + Intergenic
947565334 2:231189793-231189815 GGGAGGGAGGAGGGGGCCCCCGG + Intergenic
947752906 2:232541983-232542005 AAGTGTGGGGAGGAGGGCCCGGG + Intronic
948002197 2:234577445-234577467 GAGACAGAGGAGGAGGTGCCAGG + Intergenic
948035031 2:234851587-234851609 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
948233220 2:236366798-236366820 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
948603362 2:239119937-239119959 GAGAGTGAGCAGGAGGCACCAGG + Intronic
948603379 2:239120008-239120030 GAGAGTGAGCAGGAGGCACCAGG + Intronic
948640421 2:239372306-239372328 AGGAGTAAGGAGGAGGGCCCGGG - Intronic
948664088 2:239523774-239523796 GGTAGTGAGGAGGAGGGCACAGG - Intergenic
948720565 2:239897673-239897695 GAGGAGGAGGAGGAGGGCCCAGG - Intronic
948729125 2:239952291-239952313 CAGAGTGGGGAGGGGGGCCCAGG + Intronic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
948932110 2:241138535-241138557 GAAAGAGAGGATGAGGAGCCTGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1169832279 20:9838454-9838476 GAGGGCGTGGAGGAGAACCCCGG - Intronic
1170091127 20:12590716-12590738 GAGAGAGAAGAGGAGCAGCCAGG + Intergenic
1171239376 20:23552441-23552463 GAGAGTGCGAGGGAGGACCCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171399072 20:24860009-24860031 GAGGGTGAGGAAGAGGAACGGGG - Intergenic
1171971881 20:31569824-31569846 GAGAGTGGTGGGGAGTACCCAGG + Exonic
1172009509 20:31838186-31838208 GAGAGTGAGGAGGGTGTTCCAGG + Intergenic
1172209522 20:33187102-33187124 GACAGTGAGGGCCAGGACCCCGG + Intergenic
1172299070 20:33835851-33835873 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1172702284 20:36861081-36861103 CAGAGTGAGTAGCAGGAACCGGG + Intronic
1172972257 20:38882188-38882210 GAGAATGAGGAGTGGGATCCTGG + Intronic
1173002516 20:39114668-39114690 GAGAGTGAAGAGGAGAGTCCAGG + Intergenic
1173821357 20:46022252-46022274 CAGAGTGAGGAGGTGGAACTAGG + Intronic
1173912230 20:46678939-46678961 GAGAGAGAAGGGGAGGAGCCGGG - Intronic
1174292566 20:49519490-49519512 AAGGGTGAGGAGGAGGGGCCAGG - Intronic
1174562426 20:51440867-51440889 TGGAGTGGGGAGGAGGAGCCTGG - Intronic
1175048803 20:56133416-56133438 GAGAGGGAGGAGGAGTAACCTGG - Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175199196 20:57266386-57266408 GCGAGTGAGGAGGCGGGCGCGGG + Exonic
1175482788 20:59323227-59323249 GAGCGGGAGGAGGAGGGCCGAGG + Intronic
1175565223 20:59970139-59970161 GAGCTGGAGGAGGAAGACCCGGG + Exonic
1175581713 20:60104897-60104919 GAGAGAGAGAAGGAGGTGCCAGG + Intergenic
1175861166 20:62151215-62151237 GGGAGTGAGGATGAGAACCAGGG - Intronic
1176241678 20:64078481-64078503 TAGAGTGTGGGGGAGGACCCTGG - Intronic
1176455979 21:6911155-6911177 GAGGAGGAGGAGGAGGACGCGGG + Intergenic
1176834153 21:13776203-13776225 GAGGAGGAGGAGGAGGACGCGGG + Intergenic
1176985565 21:15431863-15431885 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1177431596 21:20997792-20997814 GAGAGGGAGAAGGAGGTCCACGG + Intergenic
1178155259 21:29846047-29846069 GCCAGTGGGGAGGAGGATCCAGG - Intronic
1178668156 21:34566834-34566856 GCGAGAGAGGAGGAGGTGCCAGG + Intronic
1178749094 21:35283718-35283740 CAGAGTGATAAGGAGGTCCCAGG + Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179420516 21:41232632-41232654 GAGAGAGAGGAGGAGGTGCCTGG - Intronic
1179447806 21:41445379-41445401 GAGAATGAAAAGGAGGTCCCGGG - Intronic
1179612258 21:42559957-42559979 AAGAGTGAGGGGGAGGATGCAGG + Intronic
1179649311 21:42796529-42796551 AAGAATGAGGAAGAGGTCCCAGG - Intergenic
1179810436 21:43865842-43865864 GCGCGCGAGGAGGAGGCCCCTGG - Intronic
1179941235 21:44639752-44639774 GAGAGCCAGGAGGAGGGCCCGGG + Intronic
1180613026 22:17109662-17109684 GAGGAAGAGGAGCAGGACCCAGG + Exonic
1180926267 22:19557203-19557225 GAGAGTGTGGAGGCAGAGCCTGG + Intergenic
1180999630 22:19982000-19982022 GTGACGGTGGAGGAGGACCCCGG - Exonic
1181309808 22:21938449-21938471 GAGAGCGAGGAGGAGAGCGCGGG + Intronic
1181393948 22:22604709-22604731 GAGAGTGAGGAGGGTGAGCAGGG - Intergenic
1181591076 22:23884905-23884927 GGGAGTGAGGACCAGGGCCCTGG - Exonic
1181963736 22:26642234-26642256 GAGGGGCAGGAGGAGGAACCAGG - Intergenic
1182134828 22:27891671-27891693 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
1182194140 22:28496856-28496878 GCAAGTGAGGAGGAGGACCAAGG - Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182404876 22:30118225-30118247 GTGAGCGAGGGGGAGAACCCAGG - Intronic
1183007754 22:34917361-34917383 AAGAATGTGGAGGAGGAACCAGG + Intergenic
1183310786 22:37108499-37108521 GGGAGTGAGGAGCAGGTGCCAGG - Intronic
1183775000 22:39958205-39958227 GAGACTGAGGAGGAGAAGCCAGG - Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184923405 22:47621393-47621415 GAGAGCCAGGAGGAAGACCCTGG - Intergenic
1185025025 22:48403911-48403933 AACAATGAGGAGGGGGACCCAGG - Intergenic
1185348304 22:50320186-50320208 GACAGTGAGGAGCCGGGCCCTGG + Intronic
949159950 3:869444-869466 GAGTGAGAGCAGGAGCACCCTGG - Intergenic
949538610 3:5014795-5014817 GAGAAAGAGGAGGAGGACAAAGG + Intergenic
949648995 3:6133046-6133068 GAGAGGGAAAAGAAGGACCCTGG + Intergenic
950140594 3:10612455-10612477 GAGAGGTAGGAGGAGAACCAAGG - Intronic
950202725 3:11056522-11056544 GAGAGGGAGGAGGAGCACAGGGG + Intergenic
950663276 3:14480120-14480142 GAGACTGTGAAGGAGGACCCCGG + Intronic
950713119 3:14828028-14828050 GAGAGGGAGCAGGAAGACCCAGG + Intronic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951417323 3:22440716-22440738 GAGAGTGATCAGAAAGACCCAGG + Intergenic
951574826 3:24102841-24102863 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
952010648 3:28897164-28897186 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
952500758 3:33959659-33959681 GAGAGGGAGGAGGAGGAAGCAGG + Intergenic
952687571 3:36167736-36167758 GAGTGAGAGGAGGGAGACCCAGG - Intergenic
952885957 3:38011071-38011093 GAAAGTGTGGAGCAGGGCCCCGG + Intronic
953546701 3:43868837-43868859 GATAGTGGGGAGAAGTACCCTGG + Intergenic
953649059 3:44783382-44783404 GAGAGAGATGAGGAGGTGCCAGG + Intronic
953682506 3:45050537-45050559 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
953807934 3:46087686-46087708 CAGAGTGAGGACTAGAACCCAGG + Intergenic
954197401 3:49004857-49004879 GCGAGTGAGGCGCAGCACCCTGG - Exonic
954242196 3:49302736-49302758 GAGAGCCAGGAGGATGAACCTGG + Intronic
954361736 3:50125847-50125869 GGCAGTGAGGAGGAGGCCCTAGG + Intergenic
954618682 3:51983581-51983603 GAGAGTGAGGTGGGGGCCCTGGG + Exonic
954717615 3:52534163-52534185 GAGAGGGCGGCAGAGGACCCGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955236595 3:57144808-57144830 GAGAGTGGGGAGAAGGACCCTGG - Intronic
955362461 3:58287415-58287437 GAGAGTGGGGAGGAGCAGCCAGG + Intronic
955476619 3:59342852-59342874 GATGATGAGGAGGAGAACCCAGG + Intergenic
956489941 3:69760213-69760235 GAGTGTGAGGTTGGGGACCCAGG + Intronic
957616774 3:82539176-82539198 GAGAGAGAGGAGGAGGGGTCAGG - Intergenic
957909817 3:86606837-86606859 GGGAGAGAGGAGGAGGTACCAGG + Intergenic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959776984 3:110177754-110177776 GTGAGTGAGGGAGAGGACTCAGG - Intergenic
960190011 3:114692608-114692630 GAGAGGGAGGAGGAGGAAAAGGG - Intronic
960250163 3:115442953-115442975 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
960747525 3:120907049-120907071 GAGAGTGGGAAGGAGGAAGCAGG - Intergenic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
961672047 3:128540302-128540324 GAGACTGAGGAGGAGTAACGTGG - Intergenic
961828007 3:129608551-129608573 GTGAGTGAGGAGGAGGGGCATGG - Intergenic
962079745 3:132125252-132125274 GAGGAGGAGGAGGAGGACACTGG - Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962621313 3:137182486-137182508 GAGAGGGTGGAGGAGGTGCCAGG - Intergenic
962684097 3:137829898-137829920 AAGAGAGAGGAGGAGGTACCAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963503954 3:146161452-146161474 GAGAGGGAGGAGGAGCCGCCGGG + Intronic
963640837 3:147859522-147859544 GAGAGAGAAGAGGAGGTCCCAGG + Intergenic
965511536 3:169573127-169573149 GAGGGTGAGGGGGAGAAGCCTGG - Intronic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
966173639 3:177111857-177111879 CAGAGTTGGGATGAGGACCCAGG - Intronic
966917922 3:184594897-184594919 GAGAAGGGGGAGGAGGACCAAGG + Intronic
967142251 3:186570864-186570886 GAGTGTGTGGAACAGGACCCGGG + Exonic
967690402 3:192467226-192467248 GAGAATTAGGAGCAGAACCCAGG - Intronic
967982185 3:195072284-195072306 TTGAGTGAGGAGCAGGAACCCGG + Intronic
967986691 3:195100563-195100585 GGGAGAGAGGAGGAGGAGGCTGG - Intronic
968884599 4:3320959-3320981 GAGAGAGCAGAGGAGGCCCCTGG + Intronic
968902417 4:3437937-3437959 GAGGGTGAGGAGGGGCACGCTGG + Intronic
968944640 4:3657260-3657282 GAGAGGGAAGAGGGGGACCAGGG - Intergenic
969125968 4:4948365-4948387 GAGACAGAGGAGCAGGACCAGGG - Intergenic
969587646 4:8103745-8103767 GTGACAGAGGAGGGGGACCCGGG + Intronic
969689114 4:8694577-8694599 GAGAGTGAGGAGGAGCAGCCGGG + Intergenic
969913557 4:10467055-10467077 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
970378429 4:15481535-15481557 GAGAGAGGGGAGGAGGTTCCAGG - Intronic
970840632 4:20464304-20464326 GATAGTCGGGAGGAGGACACGGG - Intronic
971952755 4:33375723-33375745 GAGAGTGAGTGGGAGGAACAAGG - Intergenic
972533198 4:39978071-39978093 GGGCGAGAGGAGGAGGAGCCCGG + Intergenic
972637262 4:40895429-40895451 GATGGTGAAGAGGAGGTCCCGGG + Intronic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
972930378 4:44064582-44064604 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
975389648 4:73801922-73801944 GTGAGTGAGCAAGAGGCCCCAGG + Intergenic
975619723 4:76284111-76284133 AAGAGAGAGGAGGAGGAGCCAGG - Intronic
975693343 4:76987171-76987193 GAGACTAAGGAGGAGCATCCAGG - Intronic
976132830 4:81903382-81903404 GAGAGTGAGGAGGAGAGGGCTGG - Intronic
976132915 4:81904061-81904083 GAGAGGGAGGAGAAGGATACAGG - Intronic
976186764 4:82449801-82449823 GAGTGTGAGTGTGAGGACCCAGG - Intronic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
978206740 4:106089203-106089225 GAGAGAGAGGAGGTGGAGCCAGG + Intronic
979234539 4:118385074-118385096 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
979507650 4:121515792-121515814 GAGAGTGAAGAGGAAGTTCCAGG - Intergenic
979876708 4:125900686-125900708 GAGAGAGAGGAGGAAGTGCCAGG + Intergenic
980695989 4:136356176-136356198 AAGGAGGAGGAGGAGGACCCCGG - Intergenic
980974419 4:139597467-139597489 GAGACTGAGAAGGAGCAGCCGGG - Intronic
981463287 4:145035863-145035885 GAGAGTGCTGAGGAAGACCAGGG - Intronic
981616226 4:146647664-146647686 GAGACTGAGAAGCAGGACGCGGG + Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
981906362 4:149925700-149925722 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
982138695 4:152296816-152296838 GATAGGGAGGGGGAGGCCCCAGG + Intergenic
982400634 4:154963891-154963913 GAGAGAGAGGAGGTGGTGCCAGG - Intergenic
982412115 4:155090119-155090141 GAAAGTGTGGAGACGGACCCTGG - Intergenic
982762334 4:159300874-159300896 GAGAGTCAGGAGGCAGACACAGG - Intronic
982871889 4:160590042-160590064 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
983118210 4:163846491-163846513 GAGAGTGAGGAGGATGTCACTGG + Intronic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983934876 4:173494649-173494671 GAGGGCGAGAAGAAGGACCCGGG + Intergenic
984044086 4:174776014-174776036 GAGAGTGAGAAGGGGACCCCAGG + Intronic
984349393 4:178570858-178570880 GAGAATGAGGAGGGGGCCCCAGG + Intergenic
984380908 4:178991316-178991338 GAGAGAAAGGAAGAGGTCCCAGG - Intergenic
985477727 5:89209-89231 GACAGAGGGGAGGAGGAACCAGG - Intergenic
985713941 5:1445519-1445541 GGAGGTGAGGAGGAGGAGCCAGG - Intergenic
985815597 5:2125652-2125674 GAGTGTTGGGAGGAGGGCCCAGG + Intergenic
985866460 5:2518079-2518101 GAAAGTCAGGAGAAGCACCCAGG - Intergenic
985957267 5:3275052-3275074 GAGGGGGAGGCAGAGGACCCTGG - Intergenic
986108654 5:4687866-4687888 GTGAGAGAGCAGGAGGACACTGG + Intergenic
986298018 5:6455714-6455736 GGGAGGGAGGAGGTGGACCATGG - Intronic
986399605 5:7368210-7368232 GAGAGAGAGGAGGAGGTATCGGG - Intergenic
986859031 5:11904535-11904557 GAGAGAGGGGAGGAGGCCGCGGG + Intergenic
987038220 5:14038601-14038623 CAGAGGCAGGATGAGGACCCAGG + Intergenic
987089424 5:14498031-14498053 GTGGGTGTGGAGGAGGAGCCAGG + Intronic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988775943 5:34478139-34478161 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
991259497 5:64651381-64651403 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
991605955 5:68401402-68401424 GAGAGAGAGGGGGAGGTGCCAGG + Intergenic
991927426 5:71719173-71719195 GGGGGTGTGGAGGAGGGCCCGGG - Exonic
992090625 5:73312877-73312899 GAGGGGGAGGAGGAGGAGGCAGG - Intergenic
993570604 5:89534152-89534174 GACCCTGAGAAGGAGGACCCTGG - Intergenic
994309595 5:98252933-98252955 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
994815118 5:104576218-104576240 GAGAGGGAGGAGGGGGACAGAGG - Intergenic
994869686 5:105331632-105331654 GAGAGGGAGGAGGAGGAGGGAGG + Intergenic
995530363 5:113086050-113086072 GGGACTGCGGACGAGGACCCAGG + Intronic
995675997 5:114663247-114663269 AAGAGTGAGGAGGATGACCTGGG + Intergenic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
995911079 5:117187534-117187556 GAGAGTGAGGAGGATGATTATGG - Intergenic
996090281 5:119344278-119344300 GAGAGAGGGGAGGAGGTACCAGG + Intronic
996344167 5:122471792-122471814 GAGGGTGAGGAGGAGGGTCAGGG - Intergenic
997111156 5:131076078-131076100 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
997714125 5:136029361-136029383 GGGAGGGAGGTGGAGGACCATGG + Intronic
998161498 5:139815155-139815177 GTGAGAGAAGAGGAGGATCCAGG - Intronic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
998781382 5:145660419-145660441 GAGGGTTAGGAGGAGGAGCCAGG - Intronic
999001243 5:147925226-147925248 GAGGGAGAGGAGGAGGAGCCAGG + Intergenic
999079708 5:148831544-148831566 CAGAGTCAGGACGAGAACCCAGG + Intergenic
999099359 5:149010121-149010143 GAGAGTGAGTAGGTGGGCACTGG + Intronic
999433064 5:151540475-151540497 GAGAGTGAGGAGCAGGAGAAGGG - Intronic
999517349 5:152314554-152314576 GAGAGGGAGGAGGAGGAGAGGGG - Intergenic
1000363514 5:160469657-160469679 GAGAGAGAGAAGGTGGACTCTGG + Intergenic
1000594740 5:163201979-163202001 GAGAGAGAGGAGGAGAAGCCAGG - Intergenic
1001086443 5:168703187-168703209 GAAAGTGTGGTGGAGGACCAAGG - Intronic
1001332026 5:170769191-170769213 GAGAGGGAGCAGGAGGGCTCAGG - Intronic
1001613259 5:173021168-173021190 GAGAGAGAGAAGGAGGTGCCAGG + Intronic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001916944 5:175569799-175569821 GAGAGGGAGGAGGAGCGCCAAGG - Intergenic
1002431467 5:179206609-179206631 GGGGGTGAGAAGGAGGACCAGGG - Intronic
1002872205 6:1177198-1177220 GTGAGTGAGCAGGTGGAGCCTGG - Intergenic
1002884656 6:1282767-1282789 GAGAGAGAGGAAGAGGACCCAGG - Intergenic
1003318775 6:5034546-5034568 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
1003389653 6:5702821-5702843 GAGAATGAGGAGGGAGGCCCAGG + Intronic
1004017339 6:11744144-11744166 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1004115200 6:12759879-12759901 CAGAGTGAGGATCAGAACCCAGG - Intronic
1004276866 6:14244346-14244368 CAGAATGAGGATTAGGACCCAGG + Intergenic
1004478064 6:15992765-15992787 GAGACAGGGGAGGAGGTCCCAGG - Intergenic
1005411960 6:25558784-25558806 TAGGGTGAGGAGCAGGGCCCTGG + Intronic
1005704257 6:28435866-28435888 GAGAGAGAGCTGGATGACCCAGG - Exonic
1005783272 6:29216140-29216162 AAGATTGGGGAGGAGGACCTGGG + Intergenic
1006163156 6:32049610-32049632 GAGAGTGAGGGGGATGTCCTTGG + Intronic
1006166364 6:32068001-32068023 GAGAGTGAGGGGGATGTCCTTGG + Intronic
1006296235 6:33171305-33171327 CAGGGTGAGGTGGGGGACCCCGG - Exonic
1006391565 6:33761840-33761862 GAGACTGAGGATGAGGAGACTGG - Intergenic
1006440442 6:34050465-34050487 GAAAGAGAGGAGGAGGAGCCAGG - Intronic
1006630426 6:35426698-35426720 GACAGTGGGCAGGAGGCCCCAGG + Exonic
1006792781 6:36714634-36714656 GAGAGTGGGGAGGAGAACTCAGG + Intronic
1007324951 6:41052909-41052931 GAGAGTGTGGAAGGGGCCCCAGG - Intronic
1007424005 6:41735308-41735330 GAGAGGCACGAGGAGGGCCCGGG - Intronic
1007757447 6:44109381-44109403 AAGAGTGTGGAGGAGGGCCAGGG - Intergenic
1007811907 6:44492227-44492249 GTGAGTGGGGAGGAGGTGCCAGG - Intergenic
1008044204 6:46835214-46835236 GAGAGTCATGAGGAAGATCCAGG - Intronic
1008972124 6:57380910-57380932 GAGAGAGGGGAGGAAGACACAGG - Intronic
1009313478 6:62188029-62188051 GAGAGAGAGGAGGAGGGACCAGG + Intronic
1010022660 6:71178801-71178823 GTGAGAGAGGAGGAGGTGCCAGG - Intergenic
1010752497 6:79631241-79631263 GAGAGGGAGGAGGAGGGAGCCGG - Intergenic
1010926366 6:81751346-81751368 GAGAGGGCAGAGGAGGACCTGGG + Intronic
1011129361 6:84037800-84037822 GAGAGAGAGGGGCAGGAACCCGG - Intronic
1012399831 6:98834301-98834323 GAGAGGGCGGAGGAGGCCCCGGG + Intergenic
1013484740 6:110585922-110585944 AAGAGAGAGGAGGAGGCGCCAGG - Intergenic
1014089852 6:117391431-117391453 CAGAGTGAGGAGGAGAAGCTGGG + Intronic
1015227077 6:130869909-130869931 GAGAGTGAGGAGGAAGACGTGGG - Exonic
1015489872 6:133812842-133812864 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1015559421 6:134498451-134498473 CTGGGTGAGGAGGAGGACACTGG + Intergenic
1015625955 6:135181323-135181345 GAGAAGGAGGAGGAGGAAACAGG - Exonic
1015952089 6:138563700-138563722 GAGAGTGAGGAGGAAGCACAAGG + Intronic
1016048838 6:139508143-139508165 GAGGGTGGAGAGGAGAACCCTGG + Intergenic
1016571562 6:145519341-145519363 GAGAGTGAGGAGTAGCAACATGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017049739 6:150379190-150379212 GAGAGAGAGAGGGAGGAACCAGG - Intronic
1017054723 6:150426499-150426521 GAGGGTGAGGAAGAGGACGTTGG + Intergenic
1017184022 6:151582755-151582777 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1017311403 6:152982216-152982238 GGGAGTGGGGAGGGAGACCCTGG + Intronic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1017996290 6:159534271-159534293 GGGAGTGAGGAGGACGAGGCTGG + Intergenic
1018267343 6:162039495-162039517 GAGAGAGAGAAGGAGGTGCCAGG - Intronic
1018366198 6:163122534-163122556 GAGAGCGAGGGGGAGGTGCCAGG - Intronic
1018736113 6:166688337-166688359 GAAATTGAGGTTGAGGACCCTGG - Intronic
1018791044 6:167147983-167148005 AAGAGGGAGGAGGAGGAAGCAGG - Intronic
1019279002 7:191018-191040 GAGGGTGAGGAGGAAGATCCCGG - Intergenic
1019307863 7:344360-344382 GAGAGGGAGGCTGAGGGCCCTGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019371842 7:666189-666211 GGGAGTGAGGTGGAGGCCCTTGG - Intronic
1019428723 7:988868-988890 GAGAGAGGGTGGGAGGACCCAGG - Exonic
1019516975 7:1444482-1444504 GGGAATGGGGAGGAGGAGCCAGG - Intronic
1019727990 7:2613486-2613508 GAGAAAGAGGAGGAGGCCCCAGG + Exonic
1019884209 7:3889933-3889955 AAAAGTGAGGAGGAGGAGCGGGG - Intronic
1020775757 7:12451692-12451714 GACAATGAGGAAGAGGAGCCAGG - Intergenic
1021546779 7:21822321-21822343 GAGAATGGGCAGGAGGAGCCAGG + Intronic
1021863569 7:24931939-24931961 GAGAGTGAGGATGAGAGCCCAGG - Intronic
1022180788 7:27917306-27917328 GAGAGTGAGGAGAGGCACGCTGG - Intronic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023020240 7:36005447-36005469 TAGAGTGAGGAGGTAGACCAGGG + Intergenic
1023383499 7:39632007-39632029 GAGAGAGAGGAGGAGGTTCTGGG + Intronic
1023765607 7:43507883-43507905 GAGAGGAAAGAGCAGGACCCAGG - Intronic
1023840295 7:44093333-44093355 GAGAGAGAGGAGGAAGTTCCAGG - Intergenic
1024242036 7:47443131-47443153 AACAATGAGGAGGTGGACCCAGG - Intronic
1024632654 7:51262335-51262357 GAAAGTGAGGAGGGAGACCCTGG + Intronic
1025058668 7:55785621-55785643 CAGAGTGGGGTGGAGGACTCAGG + Intergenic
1025215388 7:57051679-57051701 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1025220503 7:57103536-57103558 CAGAGTGGGGTGGAGGACTCAGG + Intergenic
1025222250 7:57123229-57123251 GAGTGTGAGGTGGAGGAGCCAGG + Intronic
1025266740 7:57466511-57466533 GAGTGTGAGGTGGAGGAGCCAGG - Intronic
1025626132 7:63224101-63224123 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1025633033 7:63294910-63294932 GAGTGTGAGGTGGAGGAGCCAGG + Intergenic
1025649664 7:63453273-63453295 GAGTGTGAGGTGCAGGAGCCAGG - Intergenic
1025743119 7:64217206-64217228 GAGTGTGAGGTGGAGGAGCCAGG - Intronic
1026214439 7:68335781-68335803 GAGAGGGAGGAGAAGGACAGAGG + Intergenic
1026466840 7:70661753-70661775 GAGTCTGGGGAGGTGGACCCAGG + Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026767051 7:73166791-73166813 GAGGGGGAGGAGGAGGAGACAGG - Intergenic
1026879632 7:73900444-73900466 GAGAGTGGGGAGGGGGAAGCAGG - Intergenic
1026935680 7:74254141-74254163 CCGAGGGAGGAGGAGGCCCCGGG - Intronic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1028268606 7:88759396-88759418 GAGAGGGCGGAGGAGGAGACGGG - Exonic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1029304710 7:99610452-99610474 CAGAGTATGGAGGAGGACCACGG + Intergenic
1029487615 7:100852947-100852969 TTGGGGGAGGAGGAGGACCCGGG + Intronic
1029575665 7:101401775-101401797 GAGGAGGAGGAGGAAGACCCTGG + Intronic
1030102905 7:105962084-105962106 GAGAGTGAGGGGTTTGACCCAGG - Intronic
1030149117 7:106385166-106385188 AAGGGTGAGGAGGAGAAGCCAGG + Intergenic
1030317582 7:108132278-108132300 GAGAATGAGGAGGAGGGATCTGG - Intergenic
1030367123 7:108657977-108657999 GGGAGTGAGGGAAAGGACCCAGG + Intergenic
1032503235 7:132415633-132415655 GAGAGTGAGGAGGAGAAAGAGGG - Intronic
1032533854 7:132644470-132644492 TGGAGTGAGAAGGAGGACACTGG - Intronic
1032795187 7:135270773-135270795 GAGAGTGAGGAGCACCAGCCAGG + Intergenic
1033422898 7:141218670-141218692 GAGGGTGAGGAAGAGGGCACCGG - Intronic
1034214837 7:149397535-149397557 AAGAGAGAGGAGGGGGAGCCTGG - Intergenic
1034277373 7:149829741-149829763 GAGACTGTGGAGGAGGACACAGG - Intergenic
1034323269 7:150204889-150204911 GAGAGTGCAGAGGAGGAGCAAGG + Intergenic
1034380460 7:150687875-150687897 GAGAGTGAGGAGGAGGGAGTGGG - Intronic
1034453247 7:151149191-151149213 GAGAGTTTGGAGGAGGCCCATGG + Intronic
1034903077 7:154919928-154919950 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1034978892 7:155463364-155463386 GAGGGTGAGGAGAGGGAGCCGGG - Exonic
1035079429 7:156203861-156203883 GAGAGAGAGAAGCAGGACCCCGG + Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1036223079 8:6937151-6937173 GATGGTGATGATGAGGACCCTGG + Intronic
1036517231 8:9455522-9455544 GAGAGGGAGGAGGGGGACATGGG + Intergenic
1036601051 8:10260408-10260430 GAGACAGAGGAGGAGGAAGCGGG + Intronic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037704616 8:21308841-21308863 GAGACTGAGGAGGAGAAAACAGG + Intergenic
1037760418 8:21738176-21738198 GAGGGGGAGGAGGAGGAACGGGG - Intronic
1038160609 8:25033665-25033687 GAGAGGTAGGAGGATTACCCTGG + Intergenic
1038962739 8:32539365-32539387 AAGAATGAGGAAGAGGACCCAGG + Intronic
1039028851 8:33287672-33287694 GAGTCTGAGCAGGAGGACCTGGG - Intergenic
1039554234 8:38465662-38465684 GAGAGGAAGGTGGATGACCCGGG + Intronic
1039965653 8:42281682-42281704 GAGACTGGGCAGGAGGACCCAGG - Intronic
1040422413 8:47252494-47252516 AAAGGTGAGCAGGAGGACCCCGG - Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040886323 8:52267272-52267294 GAGGGTGAGAAAGAGGACCCTGG + Intronic
1040914976 8:52559470-52559492 GAGAGTGAGGAGGAGAAAGGTGG - Intronic
1041167156 8:55101952-55101974 GCGAGGGAGGAGGAGGGACCCGG - Intergenic
1042032238 8:64489040-64489062 GAGAGAGAGGAGGAGGAGTCAGG + Intergenic
1042199603 8:66268733-66268755 GGGAGTGAAGATGAGGAGCCTGG - Intergenic
1042829279 8:73009058-73009080 GAGGAGGAGGAGGAGGACGCGGG + Exonic
1043762972 8:84093171-84093193 GAGAGAGAGGGGGAGGTGCCAGG + Intergenic
1043920704 8:85980246-85980268 GAGAGAGAGGAGGAGGGGCCAGG - Intergenic
1044501635 8:92965487-92965509 AAGAGTGAAGAGGAGTACCATGG + Intronic
1044534707 8:93345488-93345510 GAGAGTGAGGTGGAGGAGTTGGG - Intergenic
1044584014 8:93852141-93852163 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1044857712 8:96493716-96493738 GAGGAGAAGGAGGAGGACCCGGG + Exonic
1044941322 8:97347188-97347210 GAGAGGGAGGAGGAGGATCCAGG + Intergenic
1045015596 8:97998997-97999019 GAGATGGAGGAGGAGGAGCTGGG - Intronic
1045495028 8:102700849-102700871 GAGGCTGGGGAGGAGGAGCCTGG - Intergenic
1046979456 8:120321023-120321045 AAGAGTGAAGTGTAGGACCCAGG - Intronic
1047139844 8:122125602-122125624 GAGAGAGTGGAGGAGGTGCCAGG + Intergenic
1047141224 8:122141836-122141858 TAGGGTGAGGAGGAGGACCCAGG + Intergenic
1047288966 8:123512555-123512577 AATAGTGAGCAGGAGGACCAAGG - Intronic
1047408778 8:124607174-124607196 AAGAGGGATGAGGAGGAGCCAGG - Intronic
1047442041 8:124887037-124887059 GAGAGAGAGGCCGAGTACCCAGG - Intergenic
1047541222 8:125768486-125768508 GAGAAGGAGGAGGAGGACCCAGG + Intergenic
1047549279 8:125852088-125852110 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
1047938693 8:129806793-129806815 GAGAGAGAGGAAGAGGTGCCAGG - Intergenic
1048082823 8:131147746-131147768 GGGAGTGAGGAGGAGAACGATGG - Intergenic
1048577732 8:135706237-135706259 GAGAGTGTGGGGGAGGGCCATGG + Intergenic
1049037402 8:140087222-140087244 GAGACAGAGGAGGAAGAGCCAGG - Intronic
1049235006 8:141508044-141508066 TAGGGTGAGGACGAGGCCCCTGG + Intergenic
1049367948 8:142249763-142249785 GAGAGGGAGGAGGAGTGCCACGG - Intronic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1051055563 9:12980975-12980997 GAGAGACAGGAGGAGAAACCAGG - Intergenic
1051261968 9:15273486-15273508 GAGGGTGAGGAGGAGGAACGCGG - Intronic
1051347903 9:16169159-16169181 AGGAGTGAGGAGGAGGATCTTGG - Intergenic
1052558408 9:30050559-30050581 TAGGGTGAGGAAGAGGAACCAGG - Intergenic
1053006356 9:34607449-34607471 CTGAGTGATGTGGAGGACCCTGG - Intergenic
1054852299 9:69860338-69860360 GAGAGAGGGGAGGAGGTGCCAGG + Intronic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055868231 9:80841605-80841627 TAGAGTGAGGAGGAGGGCTTTGG - Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056799211 9:89679859-89679881 GAGTGTGTGGAGGAGGAGACAGG + Intergenic
1057017317 9:91664027-91664049 GAGAGTGTGGAGGATGACTCTGG - Intronic
1057161160 9:92889327-92889349 GAGGGTGGGGAGGAGTAGCCTGG - Intergenic
1057173142 9:92975784-92975806 GAGGAGGAGGAGGAGGACACCGG + Intronic
1057255199 9:93540751-93540773 CAGAGTGAAGAGGAGGTCACAGG - Intronic
1057361598 9:94378345-94378367 GAGAGAGGGGAGGAGGTGCCAGG + Intronic
1057379662 9:94556092-94556114 GAGAGTGGCAAGGAGGAGCCGGG + Intergenic
1057661759 9:97009825-97009847 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1057757193 9:97847985-97848007 GAGAGTGGGGAGGAGGCCAGAGG + Intergenic
1057948704 9:99352537-99352559 GAGAGTCAGGAGGGATACCCAGG + Intergenic
1058328278 9:103725818-103725840 AAGAGTGAGGAGGACTACCATGG + Intergenic
1058541194 9:106014251-106014273 GAGGGTGAAGAGGAGGACAGAGG - Intergenic
1058924786 9:109652369-109652391 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1059021354 9:110579785-110579807 GAGAGAGAGGAGGAGGAGAGAGG - Exonic
1059233198 9:112740428-112740450 AAGAGAGAGGAGGAGGTCCCAGG - Intergenic
1059331821 9:113540433-113540455 GAGAGAGATGAGGAGGGCACTGG + Intronic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1059836499 9:118160334-118160356 GAGACTGAGAAGGAGCAACCTGG - Intergenic
1060053435 9:120392984-120393006 GAGAGGGAGAAGCAGGAACCAGG - Intronic
1060269325 9:122129664-122129686 GAGTGGGAGGGGGAGGAACCAGG + Intergenic
1060980314 9:127788122-127788144 CAGAGCTGGGAGGAGGACCCAGG + Intronic
1060983086 9:127804549-127804571 GAAGGTGAGGGGCAGGACCCTGG + Exonic
1061088918 9:128415599-128415621 GAGAGGGAGGATGGGGATCCAGG + Intronic
1061450442 9:130664506-130664528 GACGGAGAGGAGGAGGACGCAGG - Intergenic
1061573135 9:131489914-131489936 GAGACTGAGGAGGAGGCCTGAGG - Intronic
1061675619 9:132214063-132214085 GGCAGGGAGGAGGAGGCCCCAGG - Intronic
1061824762 9:133251242-133251264 GGCGGTGAGGAGGGGGACCCAGG + Intronic
1061941597 9:133887017-133887039 GAGGGAGAGCAGGAGGGCCCGGG - Intronic
1062218125 9:135400002-135400024 GAGAGGGAGGAAGGGGCCCCAGG + Intergenic
1062694638 9:137867146-137867168 GAGAGTGAGGAGCTTGACCAAGG - Intronic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1186149332 X:6657594-6657616 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1186193550 X:7089329-7089351 GAGAGTGAGGTGAAGGGACCTGG + Intronic
1186687994 X:11945673-11945695 GAGAGAGAGGAGTAGGTGCCAGG + Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186875886 X:13817257-13817279 GAGAGCAAGGAGGAAGAGCCCGG - Exonic
1186920279 X:14271016-14271038 GAGAGTGAGGTGGAAGGGCCAGG - Intergenic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187050503 X:15691246-15691268 GAGGGAGAGGAGGAGGTACCAGG + Intronic
1187452844 X:19413783-19413805 GAGGGTGAGGAGGAGGAGAGTGG + Intronic
1187746641 X:22416321-22416343 AAGAGAGAGGAGGAGGTACCAGG - Intergenic
1190630430 X:52380755-52380777 GAGTGTGAGGAGGAGCCCGCGGG + Intergenic
1190648325 X:52544006-52544028 GAGAGTGAGGAGGAGACACTGGG + Intergenic
1190904726 X:54715674-54715696 GAAAGTAATGAAGAGGACCCTGG + Intergenic
1191954787 X:66632455-66632477 GAGGGTGAGGAGGAGGAGAAGGG + Intronic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192216467 X:69162844-69162866 GATAGTGAGGAGGAGGGGGCTGG - Exonic
1192217925 X:69176995-69177017 GAGACAAAGGAGGAGGACTCTGG - Intergenic
1192553670 X:72073180-72073202 GAGACTGTGGAGGAGCAGCCAGG + Intergenic
1192885010 X:75327838-75327860 GAGGAGGAGGAGGAGGACCCGGG - Intergenic
1193792694 X:85835024-85835046 AAGAGGGAGGAGGAGGAGCAAGG - Intergenic
1193944312 X:87713778-87713800 GAGAGAGAGAAGGAGGTCCCAGG - Intergenic
1194764319 X:97831538-97831560 GAGAGAGAAGAGGAGGTGCCAGG - Intergenic
1194825037 X:98551117-98551139 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1196041867 X:111213458-111213480 GAGAGAGATGAGAAGGACTCAGG + Intronic
1197347951 X:125346930-125346952 GAGAGAGAGAAGGAGGTTCCAGG + Intergenic
1197724466 X:129767544-129767566 GTGAGGGAGGAGGAGGAACTGGG - Intronic
1197744374 X:129921263-129921285 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1198051209 X:132955389-132955411 GAGAGTGAAGAGGAGAGCCAGGG + Intronic
1198264947 X:135000259-135000281 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
1199894748 X:152118645-152118667 GAGGGTGAGGAGGAGGGTCAGGG + Intergenic
1200117184 X:153774541-153774563 GAGGGTGAGGAGGAGCACGGCGG - Exonic
1200141209 X:153903942-153903964 GGGAGGGAGGAGGAGGGCTCAGG + Intronic
1200162396 X:154016277-154016299 CAGGGTGAGGAGGAGGGCCTCGG + Intronic
1200257826 X:154594163-154594185 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic