ID: 1152124354

View in Genome Browser
Species Human (GRCh38)
Location 17:78437573-78437595
Sequence GGCCCCAAGGGATGGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124344_1152124354 10 Left 1152124344 17:78437540-78437562 CCAGAGTTCAGAGCGGTCCTCAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 192
1152124339_1152124354 28 Left 1152124339 17:78437522-78437544 CCCAGAGGGGAGGTGTCCCCAGA 0: 1
1: 0
2: 4
3: 14
4: 235
Right 1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 192
1152124343_1152124354 11 Left 1152124343 17:78437539-78437561 CCCAGAGTTCAGAGCGGTCCTCA 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 192
1152124349_1152124354 -7 Left 1152124349 17:78437557-78437579 CCTCAGTGGTCCTCGGGGCCCCA 0: 1
1: 0
2: 1
3: 12
4: 197
Right 1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 192
1152124342_1152124354 12 Left 1152124342 17:78437538-78437560 CCCCAGAGTTCAGAGCGGTCCTC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 192
1152124340_1152124354 27 Left 1152124340 17:78437523-78437545 CCAGAGGGGAGGTGTCCCCAGAG 0: 1
1: 0
2: 1
3: 16
4: 303
Right 1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124354 Original CRISPR GGCCCCAAGGGATGGATGCC AGG Intronic