ID: 1152124511

View in Genome Browser
Species Human (GRCh38)
Location 17:78438256-78438278
Sequence GGGCCTGTCCCAGCTTCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 284}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124511_1152124517 -1 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124517 17:78438278-78438300 CAGAGGCGCTCGAGGACAAGCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1152124511_1152124518 10 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1152124511_1152124524 30 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124524 17:78438309-78438331 AGGGGTCTTGGATGGGCTCCAGG 0: 1
1: 0
2: 5
3: 33
4: 320
1152124511_1152124520 12 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124520 17:78438291-78438313 GGACAAGCGGTAGTGAGAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 167
1152124511_1152124521 18 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124521 17:78438297-78438319 GCGGTAGTGAGAAGGGGTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 116
1152124511_1152124514 -9 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124514 17:78438270-78438292 GACAGGCCCAGAGGCGCTCGAGG 0: 1
1: 0
2: 0
3: 21
4: 230
1152124511_1152124522 22 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124522 17:78438301-78438323 TAGTGAGAAGGGGTCTTGGATGG 0: 1
1: 0
2: 2
3: 12
4: 227
1152124511_1152124523 23 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124523 17:78438302-78438324 AGTGAGAAGGGGTCTTGGATGGG 0: 1
1: 0
2: 0
3: 25
4: 228
1152124511_1152124519 11 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124511 Original CRISPR GGGCCTGTCCCAGCTTCCAC GGG (reversed) Intronic