ID: 1152124512

View in Genome Browser
Species Human (GRCh38)
Location 17:78438257-78438279
Sequence TGGGCCTGTCCCAGCTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 330}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124512_1152124514 -10 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124514 17:78438270-78438292 GACAGGCCCAGAGGCGCTCGAGG 0: 1
1: 0
2: 0
3: 21
4: 230
1152124512_1152124520 11 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124520 17:78438291-78438313 GGACAAGCGGTAGTGAGAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 167
1152124512_1152124517 -2 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124517 17:78438278-78438300 CAGAGGCGCTCGAGGACAAGCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1152124512_1152124522 21 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124522 17:78438301-78438323 TAGTGAGAAGGGGTCTTGGATGG 0: 1
1: 0
2: 2
3: 12
4: 227
1152124512_1152124523 22 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124523 17:78438302-78438324 AGTGAGAAGGGGTCTTGGATGGG 0: 1
1: 0
2: 0
3: 25
4: 228
1152124512_1152124525 30 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124525 17:78438310-78438332 GGGGTCTTGGATGGGCTCCAGGG 0: 1
1: 0
2: 6
3: 22
4: 242
1152124512_1152124524 29 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124524 17:78438309-78438331 AGGGGTCTTGGATGGGCTCCAGG 0: 1
1: 0
2: 5
3: 33
4: 320
1152124512_1152124521 17 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124521 17:78438297-78438319 GCGGTAGTGAGAAGGGGTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 116
1152124512_1152124518 9 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1152124512_1152124519 10 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124512 Original CRISPR TGGGCCTGTCCCAGCTTCCA CGG (reversed) Intronic