ID: 1152124515

View in Genome Browser
Species Human (GRCh38)
Location 17:78438276-78438298
Sequence GCTTGTCCTCGAGCGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124515_1152124528 21 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124528 17:78438320-78438342 ATGGGCTCCAGGGCTGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 434
1152124515_1152124519 -9 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137
1152124515_1152124523 3 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124523 17:78438302-78438324 AGTGAGAAGGGGTCTTGGATGGG 0: 1
1: 0
2: 0
3: 25
4: 228
1152124515_1152124520 -8 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124520 17:78438291-78438313 GGACAAGCGGTAGTGAGAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 167
1152124515_1152124529 22 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124529 17:78438321-78438343 TGGGCTCCAGGGCTGAGGAGGGG 0: 1
1: 0
2: 5
3: 61
4: 607
1152124515_1152124522 2 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124522 17:78438301-78438323 TAGTGAGAAGGGGTCTTGGATGG 0: 1
1: 0
2: 2
3: 12
4: 227
1152124515_1152124530 25 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124530 17:78438324-78438346 GCTCCAGGGCTGAGGAGGGGTGG 0: 1
1: 0
2: 5
3: 116
4: 1339
1152124515_1152124527 20 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124527 17:78438319-78438341 GATGGGCTCCAGGGCTGAGGAGG 0: 1
1: 0
2: 0
3: 56
4: 546
1152124515_1152124526 17 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124526 17:78438316-78438338 TTGGATGGGCTCCAGGGCTGAGG 0: 1
1: 0
2: 3
3: 65
4: 373
1152124515_1152124521 -2 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124521 17:78438297-78438319 GCGGTAGTGAGAAGGGGTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 116
1152124515_1152124518 -10 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1152124515_1152124524 10 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124524 17:78438309-78438331 AGGGGTCTTGGATGGGCTCCAGG 0: 1
1: 0
2: 5
3: 33
4: 320
1152124515_1152124525 11 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124525 17:78438310-78438332 GGGGTCTTGGATGGGCTCCAGGG 0: 1
1: 0
2: 6
3: 22
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124515 Original CRISPR GCTTGTCCTCGAGCGCCTCT GGG (reversed) Intronic
900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG + Intergenic
900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG + Intergenic
900681461 1:3919144-3919166 CCCTGTCCTCCAGCGCCGCTCGG - Intergenic
903275443 1:22218487-22218509 ACTTGACCTCTAGCGTCTCTGGG + Intergenic
924246306 1:242088547-242088569 GCTTGGCCTCGGGCTTCTCTTGG - Exonic
1064410953 10:15103446-15103468 GCCTGTCCTCAAGCGTCTGTAGG - Exonic
1069189862 10:65473613-65473635 GCTTGGCCCTGAGAGCCTCTAGG - Intergenic
1090508546 11:127346236-127346258 TCTTGACCTCGGACGCCTCTGGG - Intergenic
1094814673 12:34171245-34171267 AGTTGTCCTCCAGGGCCTCTGGG - Intergenic
1103990596 12:124796790-124796812 GCTTGCCCTCGAGAGCCTGGTGG + Intronic
1104719804 12:131039004-131039026 GCTTGGCCTGGAGAGGCTCTGGG - Intronic
1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG + Intronic
1105925601 13:25004811-25004833 TCACGTCCTCGAGCTCCTCTTGG + Intergenic
1106039101 13:26072849-26072871 TCACGTCCTCGAGCTCCTCTTGG - Intergenic
1113799573 13:113079365-113079387 CCTCTTCCTCGAGGGCCTCTGGG - Intronic
1130224052 15:82044802-82044824 GCTGTTCCTCGAGCGCCTCGCGG - Intronic
1131532440 15:93205273-93205295 GATTGTCCCCGAGAGCCTCCAGG + Intergenic
1132568444 16:633775-633797 GCACGTCCTCGAGCGCCACGCGG - Exonic
1135396977 16:22138818-22138840 GCTTATCCTGGAGAGTCTCTCGG + Intronic
1135642645 16:24134343-24134365 GCTTGGCCTCTAGAGGCTCTGGG - Intronic
1142141151 16:88473444-88473466 GCCTGTCCTCGAGGGCCGCAGGG + Intronic
1148367746 17:47069372-47069394 TCTTGCCCTGGAGAGCCTCTGGG + Intergenic
1152124515 17:78438276-78438298 GCTTGTCCTCGAGCGCCTCTGGG - Intronic
1155347878 18:24876463-24876485 TCTTGTCCTCCAGGGCCACTGGG - Intergenic
1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG + Intergenic
1168170810 19:54587408-54587430 GATTGTCCTCCAGAGCCTCCTGG - Exonic
929936734 2:46298699-46298721 GCCTGCCCTCGCGAGCCTCTCGG + Intronic
934856754 2:97734593-97734615 TCTTGTCCTTGAGCTCCTCTGGG - Exonic
937228852 2:120385161-120385183 GCAGGTCCTCGAGGACCTCTGGG - Intergenic
948182606 2:235994429-235994451 GCTTGTACTTGTGTGCCTCTTGG + Intronic
948593387 2:239065037-239065059 TCGTGACCTCGAGTGCCTCTGGG + Intronic
1168802851 20:654143-654165 GCTTGTCTTCGACCGAGTCTGGG - Intronic
1171776454 20:29372759-29372781 AGTTGTCCTCCAGGGCCTCTGGG - Intergenic
1171817724 20:29803264-29803286 AGTTGTCCTCCAGAGCCTCTAGG - Intergenic
1174677014 20:52367875-52367897 GCTTGTCCTCGTGCAGCTGTTGG + Intergenic
1181010835 22:20039698-20039720 GCTTGTCCTGCAGCCACTCTAGG - Intronic
1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
952710672 3:36429240-36429262 GTGTGTCCTTGAGGGCCTCTAGG - Intronic
953439604 3:42906390-42906412 CCTTGTCCTCGAGCTGCTCCCGG + Exonic
957088635 3:75706894-75706916 AGTTGTCCTCCAGGGCCTCTGGG + Intergenic
963084695 3:141426133-141426155 GCTTATGCTGGAGCCCCTCTGGG - Intronic
967965307 3:194956066-194956088 TCTTCTGCTCGAGCACCTCTCGG + Intergenic
968688021 4:1974528-1974550 TCTTGTCCTTGAGTGCCACTTGG + Intronic
969509112 4:7607482-7607504 GCCTGTCATTGAGCGCTTCTTGG + Intronic
977569718 4:98616526-98616548 TCTTGCCATCCAGCGCCTCTTGG - Intronic
985442009 4:189988829-189988851 AGTTGTCCTCCAGGGCCTCTGGG - Intergenic
994167209 5:96620170-96620192 CCTTGTCCTCTAGAGCCTGTAGG + Intronic
1002335506 5:178475329-178475351 GCATGTCCAGGAGGGCCTCTTGG + Intronic
1003688209 6:8325961-8325983 TCTTGTCCTTGAGCTCCCCTGGG + Intergenic
1006655713 6:35590649-35590671 GCAAGTCCTCGAGGGCCACTAGG - Intronic
1008648901 6:53544360-53544382 GGGGGTCCTCGAGCGCCTCCCGG - Intronic
1010438191 6:75860063-75860085 CATTGTCCTGGAGTGCCTCTGGG + Intronic
1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG + Intronic
1018968076 6:168504146-168504168 GCTTCTCATCCAGCTCCTCTGGG + Intronic
1020372770 7:7452344-7452366 ACTGGTCCTCGAGGGCCTGTAGG + Exonic
1027978472 7:85186903-85186925 GCCTGTCCTAGCGCGGCTCTCGG - Intergenic
1039470420 8:37809929-37809951 GCTTGTCCTTGCCCTCCTCTGGG + Intronic
1039834508 8:41245995-41246017 GGTTGTCCTGGAGTGCCTCTCGG + Intergenic
1046806788 8:118487373-118487395 GCTTGTCTTCCAGCCCCTCCTGG - Intronic
1049180097 8:141217831-141217853 GCTGGCCCGCGCGCGCCTCTGGG - Intronic
1203369384 Un_KI270442v1:288526-288548 AGTTGTCCTCCAGAGCCTCTAGG - Intergenic
1187956442 X:24523485-24523507 GATTGTCCTGGAGGGACTCTGGG + Intronic
1200226532 X:154420696-154420718 GCCTGTACTCGAGCGGCTCCGGG + Exonic
1201068898 Y:10126434-10126456 AGTTGTCCTCCAGAGCCTCTAGG + Intergenic