ID: 1152124515

View in Genome Browser
Species Human (GRCh38)
Location 17:78438276-78438298
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124515_1152124522 2 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124522 17:78438301-78438323 TAGTGAGAAGGGGTCTTGGATGG 0: 1
1: 0
2: 2
3: 12
4: 227
1152124515_1152124518 -10 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1152124515_1152124524 10 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124524 17:78438309-78438331 AGGGGTCTTGGATGGGCTCCAGG 0: 1
1: 0
2: 5
3: 33
4: 320
1152124515_1152124523 3 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124523 17:78438302-78438324 AGTGAGAAGGGGTCTTGGATGGG 0: 1
1: 0
2: 0
3: 25
4: 228
1152124515_1152124527 20 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124527 17:78438319-78438341 GATGGGCTCCAGGGCTGAGGAGG 0: 1
1: 0
2: 0
3: 56
4: 546
1152124515_1152124519 -9 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137
1152124515_1152124530 25 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124530 17:78438324-78438346 GCTCCAGGGCTGAGGAGGGGTGG 0: 1
1: 0
2: 5
3: 116
4: 1339
1152124515_1152124528 21 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124528 17:78438320-78438342 ATGGGCTCCAGGGCTGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 434
1152124515_1152124526 17 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124526 17:78438316-78438338 TTGGATGGGCTCCAGGGCTGAGG 0: 1
1: 0
2: 3
3: 65
4: 373
1152124515_1152124525 11 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124525 17:78438310-78438332 GGGGTCTTGGATGGGCTCCAGGG 0: 1
1: 0
2: 6
3: 22
4: 242
1152124515_1152124529 22 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124529 17:78438321-78438343 TGGGCTCCAGGGCTGAGGAGGGG 0: 1
1: 0
2: 5
3: 61
4: 607
1152124515_1152124521 -2 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124521 17:78438297-78438319 GCGGTAGTGAGAAGGGGTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 116
1152124515_1152124520 -8 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124520 17:78438291-78438313 GGACAAGCGGTAGTGAGAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124515 Original CRISPR GCTTGTCCTCGAGCGCCTCT GGG (reversed) Intronic