ID: 1152124518

View in Genome Browser
Species Human (GRCh38)
Location 17:78438289-78438311
Sequence GAGGACAAGCGGTAGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124512_1152124518 9 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1152124511_1152124518 10 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1152124515_1152124518 -10 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124518 17:78438289-78438311 GAGGACAAGCGGTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124518 Original CRISPR GAGGACAAGCGGTAGTGAGA AGG Intronic