ID: 1152124519

View in Genome Browser
Species Human (GRCh38)
Location 17:78438290-78438312
Sequence AGGACAAGCGGTAGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124515_1152124519 -9 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137
1152124516_1152124519 -10 Left 1152124516 17:78438277-78438299 CCAGAGGCGCTCGAGGACAAGCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137
1152124511_1152124519 11 Left 1152124511 17:78438256-78438278 CCCGTGGAAGCTGGGACAGGCCC 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137
1152124512_1152124519 10 Left 1152124512 17:78438257-78438279 CCGTGGAAGCTGGGACAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1152124519 17:78438290-78438312 AGGACAAGCGGTAGTGAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124519 Original CRISPR AGGACAAGCGGTAGTGAGAA GGG Intronic