ID: 1152124530 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:78438324-78438346 |
| Sequence | GCTCCAGGGCTGAGGAGGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1461 | |||
| Summary | {0: 1, 1: 0, 2: 5, 3: 116, 4: 1339} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152124515_1152124530 | 25 | Left | 1152124515 | 17:78438276-78438298 | CCCAGAGGCGCTCGAGGACAAGC | 0: 1 1: 0 2: 0 3: 5 4: 59 |
||
| Right | 1152124530 | 17:78438324-78438346 | GCTCCAGGGCTGAGGAGGGGTGG | 0: 1 1: 0 2: 5 3: 116 4: 1339 |
||||
| 1152124516_1152124530 | 24 | Left | 1152124516 | 17:78438277-78438299 | CCAGAGGCGCTCGAGGACAAGCG | 0: 1 1: 0 2: 0 3: 1 4: 36 |
||
| Right | 1152124530 | 17:78438324-78438346 | GCTCCAGGGCTGAGGAGGGGTGG | 0: 1 1: 0 2: 5 3: 116 4: 1339 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152124530 | Original CRISPR | GCTCCAGGGCTGAGGAGGGG TGG | Intronic | ||