ID: 1152124530

View in Genome Browser
Species Human (GRCh38)
Location 17:78438324-78438346
Sequence GCTCCAGGGCTGAGGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1461
Summary {0: 1, 1: 0, 2: 5, 3: 116, 4: 1339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152124515_1152124530 25 Left 1152124515 17:78438276-78438298 CCCAGAGGCGCTCGAGGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1152124530 17:78438324-78438346 GCTCCAGGGCTGAGGAGGGGTGG 0: 1
1: 0
2: 5
3: 116
4: 1339
1152124516_1152124530 24 Left 1152124516 17:78438277-78438299 CCAGAGGCGCTCGAGGACAAGCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1152124530 17:78438324-78438346 GCTCCAGGGCTGAGGAGGGGTGG 0: 1
1: 0
2: 5
3: 116
4: 1339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152124530 Original CRISPR GCTCCAGGGCTGAGGAGGGG TGG Intronic