ID: 1152125045

View in Genome Browser
Species Human (GRCh38)
Location 17:78441483-78441505
Sequence CAGGGTCAACTGCGGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152125026_1152125045 28 Left 1152125026 17:78441432-78441454 CCTTGGAGCAGCCTAAGCAGGTG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1152125030_1152125045 17 Left 1152125030 17:78441443-78441465 CCTAAGCAGGTGCAGGGAGAGGC 0: 1
1: 0
2: 1
3: 57
4: 396
Right 1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1152125034_1152125045 -5 Left 1152125034 17:78441465-78441487 CCAGCCTTGGAAGGCACCCAGGG 0: 1
1: 0
2: 4
3: 29
4: 313
Right 1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1152125036_1152125045 -9 Left 1152125036 17:78441469-78441491 CCTTGGAAGGCACCCAGGGTCAA 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152125045 Original CRISPR CAGGGTCAACTGCGGGGGGT GGG Intronic
900595515 1:3478537-3478559 CAGGGTCACCTGGAAGGGGTGGG - Exonic
900745242 1:4356431-4356453 CAGGGGCAAATGAGAGGGGTGGG - Intergenic
902158658 1:14511093-14511115 TAGAGTTATCTGCGGGGGGTGGG + Intergenic
902859206 1:19232639-19232661 CAGGGTGCACTGTGGGGGATGGG + Exonic
905408781 1:37754178-37754200 CAGGCTGCACTGCGGAGGGTGGG - Intronic
905433363 1:37940615-37940637 GAGAGTCAACTGGGGTGGGTAGG + Intronic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
906247977 1:44290383-44290405 CAGGGACACCTGTGAGGGGTGGG + Intronic
906964257 1:50441185-50441207 GAGGGTGAAGTGCAGGGGGTAGG + Exonic
915632550 1:157163491-157163513 CAGGATCACCTGCAGGGGGCAGG - Intergenic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
918662491 1:187106690-187106712 CAGGGCCTACTGGGGAGGGTGGG - Intergenic
919922329 1:202174068-202174090 CAGGGTCATCTGCTGGGGCTGGG + Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
921008112 1:211113835-211113857 TAGGATCAACTGGGGTGGGTGGG + Intronic
1065133343 10:22644205-22644227 CAGAGTCAACTCCGGGAGTTTGG - Intronic
1065373815 10:25016650-25016672 CAGAGTCCACTGCGCGGGGGCGG + Exonic
1066443948 10:35464713-35464735 CAGGGTTAAAGGCTGGGGGTGGG - Intronic
1070651279 10:78238582-78238604 CAGAGACAACTGCTGGGGATGGG - Intergenic
1070955561 10:80461188-80461210 CAGGGTCACCTGTGCAGGGTAGG - Intronic
1074445945 10:113520912-113520934 CAGGGGCCAGTGCGGGGGCTGGG - Intergenic
1077080125 11:721389-721411 CAGTGTCCACTGCTGGGGGCGGG - Intronic
1077554802 11:3220771-3220793 CAGGGGCCACTGCGGAGGGCAGG + Intergenic
1077900513 11:6483680-6483702 CAGGGTCACCTGATGAGGGTGGG - Exonic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083443644 11:62692789-62692811 CAGCATCACCTGCCGGGGGTGGG + Exonic
1083608897 11:63995771-63995793 CAAGGTCATCAGCTGGGGGTAGG + Intronic
1088883564 11:113989983-113990005 CATGGTGAGCTGCTGGGGGTGGG - Exonic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1095802300 12:46281655-46281677 CAGGGGCAACTGTGGTGGCTGGG - Intergenic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1104480190 12:129100868-129100890 CAGGGTCAAATCCTGGGGGGAGG + Intronic
1111998273 13:95186484-95186506 CAGGGTGAATTTCGGGGGTTTGG - Intronic
1113098997 13:106696630-106696652 CAGGATCAAGTTCGGGGGGCAGG + Intergenic
1113901260 13:113799468-113799490 CAGGGAAAACCGCGTGGGGTCGG - Intronic
1114455082 14:22848842-22848864 CAGGGGCATCTGAGGGTGGTAGG + Intronic
1119438948 14:74615526-74615548 CATGGTCAAATGCAAGGGGTAGG - Intergenic
1119508952 14:75196369-75196391 CAGGGTCACCTGGGGGCTGTGGG - Intergenic
1122153906 14:99738935-99738957 CAGGGTCTCCTGGGGGGTGTGGG + Intronic
1122271077 14:100568686-100568708 CAAGGTTAACGGCGGCGGGTGGG - Intronic
1122428061 14:101623172-101623194 CAGGGCCAGGTGCGGGGAGTGGG + Intergenic
1122910609 14:104826132-104826154 CAGGGGGATATGCGGGGGGTGGG + Intergenic
1123180289 14:106463177-106463199 CAGGGCCAACTGGGGGCGCTCGG - Intergenic
1202946610 14_KI270726v1_random:33476-33498 CAGGGCCAACTGGGGGCGCTCGG + Intergenic
1127904747 15:63368351-63368373 CAGGGGCAACTGCTGGGCGAAGG - Intronic
1136611571 16:31369537-31369559 CAGTGGCAACTGCTGGAGGTTGG - Intronic
1138271686 16:55700204-55700226 CTGGGCCAACTGGGTGGGGTGGG + Exonic
1139547053 16:67654256-67654278 GAGGGGCATCTGCTGGGGGTGGG + Intronic
1140740139 16:77934308-77934330 CAGGGTCATCTTGGGGGTGTGGG - Intronic
1145296048 17:21593358-21593380 CAGGGTCAGCTTCTGGGGCTGGG - Intergenic
1145367746 17:22278703-22278725 CAGGGTCAGCTTCTGGGGCTGGG + Intergenic
1150622790 17:66821219-66821241 CAGGGGCTACGGTGGGGGGTGGG - Intergenic
1152038917 17:77890769-77890791 GAGTCTCAACTGTGGGGGGTGGG - Intergenic
1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG + Intronic
1152479349 17:80539694-80539716 CAGGGAGAAATGCAGGGGGTGGG - Intergenic
1152615622 17:81336539-81336561 CAGGGTCAGCTCTGGAGGGTGGG - Intergenic
1155539361 18:26851372-26851394 CAGTGTCAACGGCTGGAGGTGGG + Intergenic
1158644124 18:59229219-59229241 CAGGGTCCATTGTTGGGGGTAGG - Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163683784 19:18699404-18699426 CAGGGTCAAATCCTCGGGGTAGG + Intronic
1164565172 19:29320812-29320834 CAGGTGCAAGTGCTGGGGGTGGG + Intergenic
1164698467 19:30264373-30264395 GAGGCACAACTGCGGGGGGCGGG - Intronic
1165210732 19:34233799-34233821 CATGGTCAGCTGTGGGTGGTGGG - Intergenic
928120108 2:28577926-28577948 CAGGCTCCACTGCGGGGGTGTGG - Intronic
932101853 2:68908514-68908536 CAGGGACACCTGCGGAGGGGAGG - Intergenic
933827002 2:86171271-86171293 CAGGCTGAACTGCAGGGGCTGGG + Exonic
937122559 2:119451135-119451157 CAGGCTCACCTGCGTGGGGTAGG - Intronic
940619550 2:156093926-156093948 GAGGGACTACTGCTGGGGGTAGG - Intergenic
941962788 2:171270023-171270045 CAGGATGAAGTGCTGGGGGTGGG + Intergenic
944276205 2:197841099-197841121 TAGGGGAAACTGCGGTGGGTTGG - Intronic
1168796234 20:611772-611794 CACGGTCAAATGCTGGCGGTGGG - Intergenic
1171474279 20:25395952-25395974 CTGGGTCCACGGAGGGGGGTAGG + Intergenic
1173932511 20:46832648-46832670 CTGGGTCATCTGCTGGGGCTGGG - Intergenic
1180123539 21:45770045-45770067 CATGGTGAACGCCGGGGGGTTGG + Intronic
1181175030 22:21030398-21030420 CAGGGGCCTCTGCTGGGGGTCGG + Intronic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1182879857 22:33724067-33724089 CAGGGACACGTGCAGGGGGTGGG + Intronic
1183628555 22:39019654-39019676 CAGGTCCAACTTCGAGGGGTGGG + Exonic
1183700415 22:39448052-39448074 CAGGGTCTCCTGCTGGCGGTAGG - Intergenic
1184581918 22:45423688-45423710 GAGAGCCAACTGCGGGGGCTGGG + Intronic
1184631472 22:45783964-45783986 CAGGGACAAATGCGGGTAGTGGG - Intronic
1184729299 22:46364208-46364230 CAGCGTCAGCGGCGGCGGGTAGG + Exonic
954459891 3:50620320-50620342 CTGGGGCAACTGCGGGGAGAGGG - Intronic
955246269 3:57227801-57227823 CGGGGTCAGCTGCGGCGGGCGGG + Exonic
958729638 3:97948022-97948044 CAGGGTCATCTGCGTGGGGAAGG + Intronic
961682934 3:128611041-128611063 CAGGGTCCACAGCTGGGTGTGGG - Intergenic
964266570 3:154903618-154903640 CAGGGCCTATTGGGGGGGGTAGG + Intergenic
968469294 4:771502-771524 CAGCGTCAACTGCAGGGAGTAGG + Intergenic
968473152 4:791161-791183 CTGGGTCAGCTGCGGGGCGGGGG + Intronic
968504867 4:967086-967108 CAGGGTCTGCTGGGCGGGGTGGG - Intronic
969314720 4:6374829-6374851 CAGTGTGAACTGCGCAGGGTGGG + Intronic
969627009 4:8310794-8310816 CAGGGTCAAGAGGTGGGGGTGGG + Intergenic
970536838 4:17038573-17038595 CAGGGTCAATAGCTGGGAGTGGG + Intergenic
981104304 4:140863219-140863241 GAGGGTCAAATGCTGAGGGTGGG + Exonic
982190987 4:152855268-152855290 CTGGCACAGCTGCGGGGGGTGGG + Intronic
985520891 5:373571-373593 CATGGGCAACTGCGGTGGCTGGG + Intronic
985984705 5:3504721-3504743 CAGGGTCACCTGTGGGGTGGTGG + Intergenic
989158777 5:38370420-38370442 CTGGGCCAGCTGCGGGGGCTGGG - Exonic
993874637 5:93292224-93292246 CAGGGGCTACTGCGAGGAGTAGG + Intergenic
995081339 5:108054099-108054121 CAGGGTCTGTTGCGGGGTGTGGG + Intronic
1006024402 6:31138144-31138166 CAGGGACGACTGGGGCGGGTAGG + Exonic
1006390262 6:33754227-33754249 CAGAGTCTCCTGCTGGGGGTTGG + Intergenic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1020209757 7:6149937-6149959 CAGGATTCACTGCGGGGGATCGG - Exonic
1022600031 7:31749284-31749306 CAGGGTCAAGTGGGGTGGGCAGG + Intergenic
1031045077 7:116878654-116878676 CAGGGTCAAGTGGAGGGGGAAGG + Intronic
1033272330 7:139943912-139943934 AAGGGTCAGCTGCTGGGGGTGGG - Intronic
1042194881 8:66223415-66223437 CAGTGTCAACTGCAGGAGATGGG + Intergenic
1049301404 8:141872536-141872558 CAGGGTCAGGTGAGGGTGGTGGG + Intergenic
1049465942 8:142751372-142751394 CAGAGTCGGCTGCTGGGGGTGGG + Intronic
1050003945 9:1108325-1108347 CAGGGCCAGTTGCAGGGGGTGGG - Intergenic
1052301429 9:26956722-26956744 GCGGGTCTCCTGCGGGGGGTCGG - Intronic
1057478524 9:95426173-95426195 CAGGGTGAGATGCAGGGGGTGGG - Intergenic
1060228995 9:121813429-121813451 CAGAGCCAGCGGCGGGGGGTTGG - Intergenic
1061038265 9:128125409-128125431 CAGGGTCAGCTGCAGGCGGCTGG + Exonic
1061084317 9:128390332-128390354 CAGGGTCAAGGGCTAGGGGTGGG - Exonic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062206211 9:135338871-135338893 CAGGGTTAGCTGCAGGGGCTGGG - Intergenic
1062729325 9:138100395-138100417 CAGGGACAGCTGGGGAGGGTGGG + Intronic
1188473014 X:30561352-30561374 CAGTGACAATTGCTGGGGGTAGG - Intronic
1194633022 X:96310059-96310081 CAGGGGAAACTGTGTGGGGTAGG + Intergenic
1198672478 X:139095851-139095873 CAGGGAAAACTGTGAGGGGTAGG + Intronic
1200667756 Y:6048490-6048512 TAGGGTCAACTGTTGGTGGTGGG - Intergenic
1202353296 Y:24017891-24017913 CTGGGTCCAATGAGGGGGGTAGG + Intergenic
1202517483 Y:25652224-25652246 CTGGGTCCAATGAGGGGGGTAGG - Intergenic