ID: 1152128303

View in Genome Browser
Species Human (GRCh38)
Location 17:78460633-78460655
Sequence CATTCTGACCTGAGCGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152128303_1152128307 1 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128307 17:78460657-78460679 GCAATGCCTCGACAGTTGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1152128303_1152128305 -3 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128305 17:78460653-78460675 ATGAGCAATGCCTCGACAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 47
1152128303_1152128308 2 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128308 17:78460658-78460680 CAATGCCTCGACAGTTGGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 42
1152128303_1152128306 -2 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128306 17:78460654-78460676 TGAGCAATGCCTCGACAGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1152128303_1152128312 15 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128312 17:78460671-78460693 GTTGGGTGGGATTCTGGAATGGG 0: 1
1: 1
2: 1
3: 9
4: 191
1152128303_1152128311 14 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128311 17:78460670-78460692 AGTTGGGTGGGATTCTGGAATGG 0: 1
1: 0
2: 0
3: 35
4: 259
1152128303_1152128310 9 Left 1152128303 17:78460633-78460655 CCCACAACGCTCAGGTCAGAATG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152128310 17:78460665-78460687 TCGACAGTTGGGTGGGATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152128303 Original CRISPR CATTCTGACCTGAGCGTTGT GGG (reversed) Intronic
900474668 1:2870489-2870511 CATTCTCCCCTGAGAGCTGTGGG + Intergenic
901176760 1:7307473-7307495 CATTCTCACATAAGCTTTGTAGG - Intronic
901875250 1:12163809-12163831 GAGGCTGTCCTGAGCGTTGTGGG + Intergenic
903952152 1:27002123-27002145 CCTTCAGACCCGAGGGTTGTGGG - Intergenic
904324419 1:29718755-29718777 TATTCTTAGCTGAGGGTTGTGGG - Intergenic
913449707 1:118984824-118984846 CAGTCCGGCCTGCGCGTTGTAGG - Intronic
923842322 1:237686503-237686525 CATTCTGAGCTGAGTTTTGAGGG + Intronic
1062974475 10:1673120-1673142 AATACTGACCTGAGAGTTGATGG + Intronic
1066413755 10:35199647-35199669 CAGTCTGACCTGGGTGTAGTTGG - Intronic
1067704065 10:48594214-48594236 CATCCTGGCCTGTTCGTTGTGGG - Intronic
1070692285 10:78536231-78536253 CATTCTTGCCTGGGTGTTGTAGG + Intergenic
1072903948 10:99433442-99433464 CTTTCTGTCTTGAGCCTTGTAGG + Intergenic
1072956982 10:99895703-99895725 CATGTTGACCTGAGCCTTATAGG - Intronic
1076797002 10:132803244-132803266 CCTTCTGTCCTGAGGGTTGTGGG + Intergenic
1078124708 11:8549606-8549628 CATTGGGTCCTGAGCTTTGTTGG + Intronic
1083166536 11:60891494-60891516 CCTTCTCACCTGAGCTTTCTGGG + Intronic
1085320954 11:75573620-75573642 GATTGTGACCTGGGGGTTGTTGG + Intergenic
1090037702 11:123263183-123263205 CATTCTGGGCTGATTGTTGTTGG + Intergenic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1093798379 12:23341264-23341286 CTTTTTGACCTAAGCTTTGTTGG + Intergenic
1096557980 12:52415483-52415505 CATTCTGCCCTGGGAGTCGTTGG - Intergenic
1102545564 12:113652535-113652557 CATGCTGTCCTGTGCGTTTTAGG + Intergenic
1102607581 12:114080511-114080533 CATTCTCACCAGAGAGTGGTGGG - Intergenic
1123388079 15:19839441-19839463 CATTGTGATCTGAGCATTATAGG + Intergenic
1128045390 15:64613410-64613432 CATTCTGACAAGAGCTTTGTGGG + Intronic
1128698826 15:69789155-69789177 AAGTCAGACTTGAGCGTTGTGGG + Intergenic
1138845412 16:60559102-60559124 CTTTCTGACCTCAGAGTTGTTGG + Intergenic
1138952137 16:61925876-61925898 CTTTCTGACCTGATCCTGGTTGG - Intronic
1139257637 16:65558152-65558174 CATTCACACCTGAGGGATGTAGG - Intergenic
1140580170 16:76222254-76222276 CATTCTGACCTGGACTTTGGGGG - Intergenic
1141669402 16:85483946-85483968 CTTTCAGACCTAAGCGTTGGAGG + Intergenic
1146776903 17:35627492-35627514 AAGTCTGACCTGAGCAATGTTGG - Exonic
1146803858 17:35849554-35849576 GATGCTGCCCTGTGCGTTGTAGG + Intronic
1152128303 17:78460633-78460655 CATTCTGACCTGAGCGTTGTGGG - Intronic
1154534158 18:15380710-15380732 CATTGTGATCTGAGCATTATAGG - Intergenic
1155637605 18:27974355-27974377 CATTCTGACATGACAGTTGTTGG - Intronic
1157402398 18:47399546-47399568 CATTCTAACCTGAGACTTGGTGG + Intergenic
1158279928 18:55813430-55813452 ACTTCTGACCTGAGGGTTGCAGG - Intergenic
1164907092 19:31976439-31976461 CATTCTGACATGAGATTTGGAGG + Intergenic
926707102 2:15844641-15844663 CATTCTGATCTGAGGGATGAGGG - Intergenic
926974281 2:18497639-18497661 CCTGCTGACCTGTGCATTGTAGG + Intergenic
932659992 2:73643519-73643541 CATTCTGATCAGACCGTTGCTGG - Intergenic
932666561 2:73703178-73703200 CATTCTGATCAGACCGTTGCTGG - Intergenic
933307204 2:80616552-80616574 CATTCTGACCAGACAGATGTAGG - Intronic
935470200 2:103450291-103450313 GAAGCTGACCTGGGCGTTGTAGG - Intergenic
937564830 2:123272240-123272262 CATTATGACCTGAGACTTATGGG + Intergenic
939994650 2:148908490-148908512 CACCCTGACCTTAGCGTAGTAGG + Intronic
945505839 2:210639202-210639224 CATTCCTACCTGACCATTGTAGG - Exonic
948655017 2:239471132-239471154 CATTCTATCCTGGGTGTTGTGGG - Intergenic
948733556 2:239983090-239983112 CATTCTGACCTGAGTGACTTCGG - Intronic
1173655109 20:44694794-44694816 GATTCTGACCAGAGCCTGGTGGG + Intergenic
1173859067 20:46270226-46270248 CATTCTGACCTGATGGTGCTGGG + Intronic
1174564185 20:51452828-51452850 CATTCAGACCTTACCTTTGTGGG + Intronic
1177911167 21:27034079-27034101 TAGTCTGACCAGAGCATTGTAGG - Intergenic
1179315328 21:40238831-40238853 CATTCTCACCTGAAAGTGGTAGG - Intronic
953839153 3:46374829-46374851 CACCCTGACCTGAGGGCTGTTGG - Exonic
956385758 3:68717324-68717346 TATTCTGACCAGAGCCTGGTAGG + Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
963988633 3:151627497-151627519 CATTCTGACCTCAAGCTTGTGGG - Intergenic
969440159 4:7212221-7212243 CATGCTGACCTGTGCCGTGTGGG - Intronic
974667846 4:64988435-64988457 CATCCTGAACTGAGTATTGTGGG + Intergenic
995229085 5:109738253-109738275 CATTCTTGCCTGATCTTTGTTGG + Intronic
1003477970 6:6502385-6502407 CATCCAGGCCTGAGTGTTGTTGG - Intergenic
1006045408 6:31291589-31291611 CATTATGACCTGAGTTTTATCGG + Intronic
1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG + Exonic
1016123412 6:140371755-140371777 CATTCTGATCTGATGGTGGTGGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017941869 6:159060486-159060508 CATTCTGAGCTGGGCTTTGTGGG - Intergenic
1018606707 6:165605285-165605307 CATTCTGAGCTGTGACTTGTTGG - Intronic
1030486154 7:110170534-110170556 CGTACTGACCTGAGCATTGTAGG - Intergenic
1033905424 7:146195793-146195815 CATTCTGAGGCGTGCGTTGTAGG - Intronic
1035625146 8:1066079-1066101 CACTCAGACCTGACCGTTGTGGG - Intergenic
1035625166 8:1066178-1066200 CACTCAGACCTGACCGTGGTGGG - Intergenic
1035625214 8:1066409-1066431 CACTCAGACCTGACCGTGGTGGG - Intergenic
1035625233 8:1066483-1066505 CACTCAGACCTGACCGTGGTGGG - Intergenic
1035625240 8:1066516-1066538 CACTCAGACCTGACCGTGGTGGG - Intergenic
1035625248 8:1066549-1066571 CACTCAGACCTGACCGTGGTAGG - Intergenic
1035625263 8:1066615-1066637 CACTCAGACCTGACCGTGGTGGG - Intergenic
1036820250 8:11934318-11934340 CATTCTGACCAGAGGCTTTTTGG + Intergenic
1041673854 8:60517834-60517856 TATTCTGACGTGAGAGTTGAAGG - Intronic
1047025556 8:120819983-120820005 CATTCTGACATGAGTTTTGGGGG - Intergenic
1048570892 8:135654984-135655006 CATTCTGACCTGCCGGTTGATGG + Intronic
1049184039 8:141239628-141239650 CATTTTCACCTGAACGTGGTAGG + Intronic
1050508765 9:6372610-6372632 CATTCTTTCCTGTCCGTTGTTGG - Intergenic
1050928652 9:11297578-11297600 CATTCTGAGCAGATCTTTGTGGG - Intergenic
1053935998 9:43152165-43152187 CATTGTGATCTGAGCATTATAGG - Intergenic
1185519860 X:730180-730202 ACTTCTGACCTGGGCGTTGGCGG - Intergenic
1186877179 X:13828046-13828068 CATTGTGACATGAGCACTGTAGG - Intronic
1194647351 X:96473609-96473631 CATTCTGACCCCAGAGTTGGGGG + Intergenic
1199583004 X:149379186-149379208 CATTCTCATCTGAGCTTTATGGG - Intergenic
1200208096 X:154332440-154332462 CATCCTGACCACAGCTTTGTGGG - Intergenic
1200251069 X:154554051-154554073 CCGCCTGACCTGAGCTTTGTGGG + Intronic