ID: 1152129510

View in Genome Browser
Species Human (GRCh38)
Location 17:78467411-78467433
Sequence CCTCACTGCGTGATGACGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152129506_1152129510 18 Left 1152129506 17:78467370-78467392 CCATTGAATGGGGTGGCTCACTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1152129510 17:78467411-78467433 CCTCACTGCGTGATGACGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152129510 Original CRISPR CCTCACTGCGTGATGACGTG AGG Intronic