ID: 1152129510 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:78467411-78467433 |
| Sequence | CCTCACTGCGTGATGACGTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 48 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 44} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152129506_1152129510 | 18 | Left | 1152129506 | 17:78467370-78467392 | CCATTGAATGGGGTGGCTCACTG | 0: 1 1: 0 2: 0 3: 8 4: 108 |
||
| Right | 1152129510 | 17:78467411-78467433 | CCTCACTGCGTGATGACGTGAGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152129510 | Original CRISPR | CCTCACTGCGTGATGACGTG AGG | Intronic | ||