ID: 1152129527

View in Genome Browser
Species Human (GRCh38)
Location 17:78467491-78467513
Sequence AGCCAAAGGCATCCCCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152129527_1152129530 1 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129530 17:78467515-78467537 ACAGATAACATTCACTAATTGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1152129527_1152129534 24 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129534 17:78467538-78467560 CTATGCAGCCCGCAGAGGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1152129527_1152129533 21 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129533 17:78467535-78467557 GGGCTATGCAGCCCGCAGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1152129527_1152129536 28 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129536 17:78467542-78467564 GCAGCCCGCAGAGGGGAGGGAGG 0: 1
1: 1
2: 5
3: 56
4: 566
1152129527_1152129529 0 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129529 17:78467514-78467536 CACAGATAACATTCACTAATTGG 0: 1
1: 0
2: 0
3: 15
4: 169
1152129527_1152129531 19 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129531 17:78467533-78467555 TTGGGCTATGCAGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 108
1152129527_1152129532 20 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129532 17:78467534-78467556 TGGGCTATGCAGCCCGCAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 116
1152129527_1152129535 25 Left 1152129527 17:78467491-78467513 CCTATCAGGGGATGCCTTTGGCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1152129535 17:78467539-78467561 TATGCAGCCCGCAGAGGGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152129527 Original CRISPR AGCCAAAGGCATCCCCTGAT AGG (reversed) Intronic
904645415 1:31962207-31962229 AGCCCAGAGCATCCCCTGGTTGG + Intergenic
905927880 1:41764875-41764897 AGCCAGAGCCATCTCCTGAGAGG + Intronic
906015994 1:42580140-42580162 AGACAAAAGCATCACCTCATTGG - Intronic
908261530 1:62343006-62343028 AGCCACAGGCTTCCCCTCACTGG + Intergenic
911525173 1:98975634-98975656 AGACATAAGCTTCCCCTGATAGG + Intronic
912498058 1:110103987-110104009 AGCTTGAGGCAGCCCCTGATCGG + Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916183698 1:162110626-162110648 AGCCTAAGCCATACTCTGATAGG - Intronic
920066730 1:203274372-203274394 AGCCAGAGGCATCATCTTATCGG + Intergenic
921303280 1:213770742-213770764 AGCCAAAAGCATCCCATTACAGG - Intergenic
922594332 1:226802526-226802548 ACCCCAAGGCATCCGGTGATGGG - Intergenic
922800586 1:228363008-228363030 AGCCAGAGGCTTCCCATGCTTGG + Intronic
1069635441 10:69922095-69922117 TGCCATAGGCAGGCCCTGATTGG + Intronic
1070484666 10:76918365-76918387 AGCCAAAGCTATCACCAGATGGG + Intronic
1073682163 10:105716368-105716390 AGCCAAAGCCATCCTTGGATAGG - Intergenic
1073798902 10:107019698-107019720 TGCCAAAGGCATGCTCAGATGGG + Intronic
1074838330 10:117322713-117322735 AGCCAAAGCCATAACCTGACTGG + Intronic
1076380517 10:130021991-130022013 AGCCAAAGTCATCCCAAGCTGGG + Intergenic
1077869758 11:6251910-6251932 AGCCAGAGCCAGCCCCTGAATGG + Intergenic
1080980431 11:37397339-37397361 AGCTAATGATATCCCCTGATGGG - Intergenic
1091162243 11:133434753-133434775 GGCCAAAGCCATCACTTGATTGG - Intronic
1091902623 12:4156733-4156755 TGCCAAAGGGATCCCCTAGTTGG - Intergenic
1099713464 12:86260413-86260435 AGGCACAGCCATACCCTGATAGG + Intronic
1100985857 12:100201032-100201054 AGCCAGAGGGATTCCCTGGTTGG + Intronic
1104391505 12:128394381-128394403 AGCCAACAGCATCCTCTGCTGGG + Intronic
1115555099 14:34539398-34539420 AGCCAAAGGGCTTTCCTGATGGG - Intronic
1118528976 14:66680275-66680297 AACCAAAAGCATCCCCTTAGTGG - Intronic
1121106598 14:91283788-91283810 AGACAAAGGGAGCCCCTGAGGGG + Intronic
1122346609 14:101064920-101064942 CGCCAAAGGAATCCTCTGCTGGG + Intergenic
1123139310 14:106059977-106059999 AGTCACAGGGATCCCCTGAGAGG + Intergenic
1123210502 14:106755813-106755835 AGACCAAGGCCTCCCCTGAGGGG + Intergenic
1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG + Intergenic
1131610698 15:93958504-93958526 AGCCACAGGCAACCACTAATAGG + Intergenic
1136019749 16:27432492-27432514 AGGCAACGGCAGCCCCTGAGTGG - Intronic
1136082268 16:27860027-27860049 AGCCAGAGGGAGCCCCTGCTGGG - Intronic
1137643513 16:50054535-50054557 AGCCAAAGGCAGCCACTGGGGGG + Intergenic
1137701989 16:50503907-50503929 AGGGAAAGGCTGCCCCTGATGGG - Intergenic
1140127888 16:72133077-72133099 AGCCACTGGCATCCCCTGCCTGG + Intronic
1141786791 16:86206238-86206260 AGGAAAAGGCAGCCCCTGCTAGG - Intergenic
1142813104 17:2405254-2405276 AGCCAGAGACATCCCCTTAGTGG + Intergenic
1145214900 17:21043571-21043593 ACCCAAAAGCACCCCCTAATCGG + Intronic
1145252796 17:21305574-21305596 AGCCAAAGGCATCCCTGGCTTGG + Intronic
1145323778 17:21782335-21782357 AGCCAAAGGCATCCCTGGCTTGG - Intergenic
1147341339 17:39754700-39754722 AGTGAAAGGCCTCCCCTCATCGG - Intergenic
1147477360 17:40724849-40724871 AGCCAAGGGCATCCTCTTCTTGG + Intergenic
1149585927 17:57786706-57786728 ACCCAAAGGCATCCCCATCTAGG - Intergenic
1150522921 17:65888367-65888389 AGACAAAGGCCTCCCCTGCAAGG - Intronic
1152129527 17:78467491-78467513 AGCCAAAGGCATCCCCTGATAGG - Intronic
1157774772 18:50384013-50384035 AGCCAAGGGAATCCCCAGAAAGG - Intronic
1158390077 18:57037864-57037886 AGCAAAGAGCATCCCCTGACAGG + Intergenic
1162460065 19:10809689-10809711 AGCAAAAGGGAGCCCCTGCTAGG - Intronic
1163233918 19:16020351-16020373 AGCCCCAGGCAGCCCCTGTTGGG + Intergenic
1165217666 19:34288085-34288107 AGCCTTAGGCCTCCCCTGCTTGG + Intronic
1166841777 19:45701856-45701878 AGCCAAAGGGCTCCCCGGGTTGG - Exonic
930034123 2:47074978-47075000 ATACAAAAGGATCCCCTGATAGG - Exonic
930091019 2:47531533-47531555 TGGGAAAGGCATCCCCTGCTGGG + Intronic
933204127 2:79485586-79485608 AGCACAAAGCATCCCATGATAGG + Intronic
939670353 2:145003203-145003225 AGCCAAAGGCTTTTCTTGATGGG + Intergenic
945276184 2:207989879-207989901 AGCCAGAGGCCTCCCCTCCTGGG + Intronic
947772406 2:232681197-232681219 ACCAAAATGAATCCCCTGATGGG - Intronic
1171442464 20:25176408-25176430 AGCCAAGGGCAGCCCCTGTCTGG + Intergenic
1172287954 20:33754428-33754450 AGCCACAGACATCCCCTGTCAGG + Intronic
1175395754 20:58660151-58660173 GGCCAAAGGCACCCCCAGCTAGG - Intronic
1180185588 21:46137616-46137638 AGACAAAGTCATCCCCTGGAGGG + Intronic
1183639194 22:39083000-39083022 AGCCACAGGCATCAGCTGAGGGG - Intronic
1183699065 22:39439725-39439747 AGCCCAAGGCTTCCTCTGCTTGG + Intergenic
953449289 3:42992620-42992642 AGGCAAAGGCAGCCCCTCTTTGG - Intronic
955883481 3:63572878-63572900 AGAATAAGGCATGCCCTGATGGG + Intronic
956163683 3:66380581-66380603 AGCCAATGGCATCTCTAGATGGG - Exonic
956450682 3:69371673-69371695 AGCCAAAGGGATTTGCTGATGGG + Intronic
956732465 3:72209209-72209231 AACCAAAGGCAACACATGATTGG + Intergenic
957330546 3:78757908-78757930 AGCCAAAGACAGGCTCTGATAGG - Intronic
957513266 3:81217320-81217342 AGCCAATCTCATCCCCAGATGGG + Intergenic
959699450 3:109285098-109285120 AGCCAAGAGCATTCCCTGATAGG - Intergenic
960054574 3:113268034-113268056 AGCCAGAGGCACCCCTTGATGGG + Intronic
962828934 3:139122876-139122898 AGCCAAAGGCAGCCCCTCAAAGG + Intronic
964455966 3:156866608-156866630 AGCCAAATGCAATCCCTGATAGG + Intronic
965913318 3:173810006-173810028 AGCCAAAGGCTGTCCTTGATAGG + Intronic
975012713 4:69376955-69376977 CGCCAAAGGCCTCCCCTGCAAGG + Intronic
986842065 5:11708844-11708866 ACCCACAGGCATCCACTGATGGG + Intronic
992877956 5:81076435-81076457 AGGCAAGGACATCCGCTGATGGG + Intronic
992877978 5:81076562-81076584 AGGCAAGGACATCCGCTGATGGG + Intronic
992877999 5:81076689-81076711 AGGCAAGGACATCCACTGATGGG + Intronic
996918597 5:128739672-128739694 AGCCCCAGGCATCTACTGATGGG - Intronic
997821301 5:137068392-137068414 GACCACAGGCATCCTCTGATGGG - Intronic
997852708 5:137346951-137346973 AGCCAACGGCACCTCCTAATGGG + Intronic
999977603 5:156927467-156927489 AAACAAAGGCCTTCCCTGATTGG - Intronic
1002016472 5:176327559-176327581 AGCAAAAGGCATACACAGATTGG - Intronic
1006845574 6:37059294-37059316 AGCCGAATGCTTCCCCTGAAAGG + Intergenic
1016870192 6:148808589-148808611 AGCAAAAGCCATCTCCTGCTGGG - Intronic
1022491543 7:30824225-30824247 AGCTCAAGGCATCACATGATGGG + Intronic
1024628051 7:51225263-51225285 TGAGAAAGGCATCCCCTGCTTGG - Intronic
1024701821 7:51911897-51911919 AGCCAATGGCAGCCTCTGGTAGG - Intergenic
1026045566 7:66903677-66903699 AGCCAAAGGCAGGGCCTGAAAGG - Intergenic
1030538839 7:110803684-110803706 AGCCAAGGGCAAGTCCTGATGGG + Intronic
1032383380 7:131505728-131505750 AGGCAGAGGCCACCCCTGATAGG - Intronic
1036156634 8:6347977-6347999 AGCCAAAGGCAGCCAGTGAGCGG - Intergenic
1036447812 8:8838226-8838248 AGCCTCAGGCAACCACTGATGGG - Intronic
1044670378 8:94674313-94674335 GGATAAAGGCATCTCCTGATGGG - Exonic
1048864644 8:138750687-138750709 GGCCACAGGCATCCACAGATGGG - Intronic
1049717453 8:144099688-144099710 AGCCCCAGGCCTCACCTGATGGG + Exonic
1053420113 9:37972089-37972111 AGGCAAGGGCAGCCCCTGAGAGG + Intronic
1055055743 9:72022312-72022334 AGCCCAAGGCCACCCCTGGTGGG - Intergenic
1060198030 9:121635790-121635812 AGCCATGGGCATCCCCTGCAGGG + Intronic
1061273053 9:129554694-129554716 AGCCAAAAGCATCCCCTCTGAGG - Intergenic
1062257196 9:135632429-135632451 AGCCACAGACATTCCATGATTGG + Intronic
1062422008 9:136487148-136487170 AGGCAAAGGCATCTCCTTTTGGG + Intergenic
1196184017 X:112726093-112726115 AGCCAAAACAATGCCCTGATGGG + Intergenic
1201190348 Y:11438653-11438675 AGCCAAAGGCTGGCCCTGGTTGG + Intergenic