ID: 1152132235

View in Genome Browser
Species Human (GRCh38)
Location 17:78484569-78484591
Sequence GAGGATCCCCCCCTCCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152132219_1152132235 18 Left 1152132219 17:78484528-78484550 CCTCTCCCGGCGGGACAGACACC 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1152132221_1152132235 13 Left 1152132221 17:78484533-78484555 CCCGGCGGGACAGACACCTCGGT 0: 1
1: 0
2: 3
3: 8
4: 52
Right 1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1152132230_1152132235 -3 Left 1152132230 17:78484549-78484571 CCTCGGTGGAAGGGGGGAAGGAG 0: 1
1: 0
2: 2
3: 29
4: 350
Right 1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1152132222_1152132235 12 Left 1152132222 17:78484534-78484556 CCGGCGGGACAGACACCTCGGTG 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152132235 Original CRISPR GAGGATCCCCCCCTCCGCGG GGG Intronic
901841144 1:11954904-11954926 GAGGATCCACCCCTCCCCGTGGG - Intronic
907487472 1:54787707-54787729 GAGGACCCCCGCCACCGAGGTGG - Exonic
911681193 1:100717894-100717916 GAGGATTGCACCCTCCTCGGTGG - Intergenic
920316063 1:205076406-205076428 CAGGATCCCCTCCTGCGCAGGGG + Exonic
1065800382 10:29346357-29346379 GAGGATGGCCACCTCCTCGGTGG + Intergenic
1067142263 10:43667653-43667675 GAGCTTCCCACTCTCCGCGGAGG - Intergenic
1067317298 10:45180669-45180691 GAGGATCGCCCCTTCAGCGTGGG + Intergenic
1070281474 10:75051971-75051993 GAGGCTCCCTCCCTCAGCTGGGG + Intronic
1075922529 10:126225049-126225071 GAGGATCCCGCCCTCTTCGGGGG - Intronic
1077115633 11:883371-883393 GAGGATGCACCCCTCAGTGGAGG - Intronic
1084501865 11:69539898-69539920 GAGGCCCCTCCCCTCCACGGAGG + Intergenic
1084889980 11:72232066-72232088 GAGGACCCCCCCCTCCCCCAGGG + Intronic
1087866767 11:103238625-103238647 GAGGTTCTCCCTCTCAGCGGAGG + Intronic
1091034880 11:132224138-132224160 GAGGATCCTCCACTACGAGGAGG + Intronic
1094848390 12:34371471-34371493 GAGGTTCCCCCCAGCCACGGGGG - Intergenic
1109546311 13:63840778-63840800 GTGCCTCCCCCCCTCTGCGGTGG - Intergenic
1122917482 14:104865660-104865682 GCGGGTCCCCGCCGCCGCGGAGG + Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132782979 16:1638670-1638692 GGGGATCCCCCCCTCTTCAGTGG + Intronic
1133346513 16:5074726-5074748 GAGGTACCCCCACTCAGCGGGGG - Intronic
1137689044 16:50407588-50407610 GAGGATCCCACCATGGGCGGAGG + Intergenic
1140256142 16:73337886-73337908 GAGGACCCCCCCCCCCGCCAAGG - Intergenic
1144682598 17:17205618-17205640 GAGAACCGCCCCCACCGCGGAGG + Intronic
1151847503 17:76667568-76667590 GAGGACTGCCCCCTCCACGGGGG - Intergenic
1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG + Intronic
1152228127 17:79102073-79102095 GATGATGCCCCCCTCCCCCGAGG + Intronic
1152532100 17:80924662-80924684 GTGCATCCCCCCCACCCCGGGGG - Intronic
1160997165 19:1888131-1888153 GAGGCTCCCAGCCTCCGCTGAGG + Intergenic
1161437263 19:4271103-4271125 GAAGTTCCCCTCCTCGGCGGGGG + Intergenic
1161493330 19:4574792-4574814 GGGGCTCCTCCCCTCCGGGGAGG + Intergenic
1163690380 19:18735406-18735428 CAGGATCCCCCGCTCCCCGGGGG - Intronic
1165928541 19:39342217-39342239 GAGGCCCGCCCCCTCCTCGGCGG - Intronic
1166868075 19:45853154-45853176 GAGTAGCCCCACCTCCGAGGTGG - Intronic
1167237170 19:48322052-48322074 AAGGCACGCCCCCTCCGCGGCGG + Intronic
1167648974 19:50719475-50719497 GAGGGTCCCCGTCTCCGGGGGGG - Intergenic
1167952429 19:53037973-53037995 TAGGCCCCCCCACTCCGCGGAGG - Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
927863140 2:26572861-26572883 GAGGAACCTCCCCTCCACGTGGG + Intronic
931710913 2:64988892-64988914 GAGGATCCCTCTCTCCCGGGTGG - Intronic
932345914 2:70994981-70995003 CAGGATCCCCCGCTCCACTGAGG + Exonic
932575792 2:72961729-72961751 GAGGATCACCCCCTCCTGGCTGG - Intronic
937247275 2:120501825-120501847 GAAGGTCCCTCCCTCCGCTGTGG - Intergenic
942103550 2:172610410-172610432 GAGGAGCCCCCCCACCATGGTGG - Intergenic
1176061658 20:63175344-63175366 GTGCTTCCCCCGCTCCGCGGGGG - Intergenic
1176305753 21:5122267-5122289 GAGGGTCCCCCACTCCCCGGGGG + Intronic
1179851305 21:44139764-44139786 GAGGGTCCCCCACTCCCCGGGGG - Intronic
1180134734 21:45855107-45855129 AAGGCTCCCTCCCTCCGTGGTGG - Intronic
1180160563 21:45997163-45997185 GAGGCTTCACCCCTCCGTGGGGG + Intronic
1182460671 22:30481547-30481569 GAGGATCTCACTCTCTGCGGGGG - Intergenic
949883723 3:8679274-8679296 GTGGCTCCCCCCCTCCGATGGGG - Intronic
956684885 3:71816929-71816951 CAGAATCCCCTCCTCCGCGGGGG + Intergenic
961319408 3:126062507-126062529 GATGATGCCCTCCTCCGCAGAGG + Intronic
967852523 3:194093185-194093207 GAAAATCCCCCCCACCGCCGCGG + Intergenic
967854253 3:194104537-194104559 GAGGGTCCCACCCTCCACAGGGG - Intergenic
968603328 4:1520603-1520625 GCGGACCCCTCCCTACGCGGCGG + Intergenic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
986714667 5:10514258-10514280 GAGGAAACCCACCTCCACGGGGG - Intronic
1004694296 6:18019763-18019785 GAGCCTCCCCCCCGCCGCCGTGG - Intergenic
1013170459 6:107633768-107633790 GAGGAAGGCCCCCTCCCCGGTGG + Exonic
1017895413 6:158675168-158675190 GAATATCCTCCCCTCCGCAGGGG - Intronic
1017987334 6:159455719-159455741 GAGCATCACCACCTCCCCGGAGG + Intergenic
1034092644 7:148378289-148378311 GAGGAAGCCCCACTCAGCGGGGG + Intronic
1034404314 7:150892093-150892115 GAGGATCCCTCCCTCAGCAGTGG + Intergenic
1034499569 7:151440762-151440784 GGGGAACTCTCCCTCCGCGGTGG - Intronic
1037558969 8:20055001-20055023 GAGCCTCCCCCACTCCGCCGTGG + Intergenic
1049573260 8:143379295-143379317 GAGCACCCCTCCCTCCGCAGGGG + Exonic
1052778955 9:32760937-32760959 GAGGAGTCCCCCCTCCTCGCAGG + Intergenic
1057259422 9:93575938-93575960 GAGGAACACCCCCACCGTGGTGG + Intergenic
1057772649 9:97982716-97982738 GAGGATCCCCCCCGTCGGGACGG - Intergenic
1059411898 9:114137786-114137808 GAGCATCCCCTCCTCCCCTGAGG - Intergenic
1062047593 9:134431675-134431697 GAGGAGCCCACCCTCCGGGCAGG + Intronic
1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG + Intergenic