ID: 1152132511

View in Genome Browser
Species Human (GRCh38)
Location 17:78485625-78485647
Sequence GGTGCTGATGGGGGACAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152132511_1152132524 20 Left 1152132511 17:78485625-78485647 CCAGCTTGTCCCCCATCAGCACC 0: 1
1: 0
2: 3
3: 27
4: 243
Right 1152132524 17:78485668-78485690 CCCCACCAGCATCACCGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 277
1152132511_1152132522 15 Left 1152132511 17:78485625-78485647 CCAGCTTGTCCCCCATCAGCACC 0: 1
1: 0
2: 3
3: 27
4: 243
Right 1152132522 17:78485663-78485685 GCGTTCCCCACCAGCATCACCGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152132511 Original CRISPR GGTGCTGATGGGGGACAAGC TGG (reversed) Exonic
900206519 1:1434095-1434117 GGCGAGGGTGGGGGACAAGCGGG + Intergenic
900251507 1:1672709-1672731 GGGGCTGGAGGGGCACAAGCTGG - Intronic
900421893 1:2559354-2559376 GGTGGAGGTGGGGTACAAGCTGG - Intronic
900899446 1:5506885-5506907 GGTGGTGTTGCGGGACAAGCTGG - Intergenic
900972582 1:5999781-5999803 GGTGCAGATGGGGTACAATCAGG - Intronic
901643195 1:10703419-10703441 GGAGCTGCTGAGGGGCAAGCAGG - Intronic
901958976 1:12809803-12809825 GGTGCTGAAGGGGGAGACTCTGG - Intergenic
902919304 1:19656895-19656917 GGTGCCCAGGGTGGACAAGCTGG + Exonic
903839047 1:26225378-26225400 GGTGCTGATGCGGGACCTGGGGG + Intergenic
904586094 1:31581435-31581457 CCTGCTGATGGGGGACATGTGGG + Intronic
904992985 1:34608688-34608710 GGGGCAGGTGGGGGAGAAGCTGG - Intergenic
905395974 1:37666902-37666924 GGTGCTGATGGGGTGCAGGGCGG - Intergenic
906283456 1:44569733-44569755 GCTGCTGAGGGGGAACAAGGAGG + Intronic
907077964 1:51595175-51595197 GGAGCTAATGGGGGCCAACCAGG + Intronic
908261843 1:62345162-62345184 GGAGCTGAGGTGGGACAAGATGG - Intergenic
912632331 1:111256517-111256539 AGTGATGATGGGGGCCAAGCTGG - Intergenic
913091756 1:115480844-115480866 GCTGCTGATGCTGGACAAGCAGG + Intergenic
913287528 1:117240553-117240575 GATGCTGTTGGGGGTCAAGGTGG - Intergenic
913332650 1:117680188-117680210 GGGGCCGGTGGGGGACAAGAGGG - Intergenic
915283332 1:154837574-154837596 GATGCTTATGGGGGAAAACCTGG + Intronic
915514890 1:156406869-156406891 GGTGCTGATGGGGCACAGAAGGG + Intronic
916216120 1:162396688-162396710 GGTGCACATGGGGGTCCAGCAGG + Exonic
916720039 1:167477899-167477921 GGTGCTGATGGGGCAGTTGCTGG + Intronic
919923340 1:202178953-202178975 GGTGATGATGGGGGTTAAGATGG + Intergenic
922462525 1:225824303-225824325 GGTGCTGAGAGGGAACAAGAAGG + Intronic
1062801810 10:386555-386577 GATGCTGTTGGGGGATAAGATGG - Intronic
1068632073 10:59308517-59308539 GGTGATGATGGGGGTGATGCTGG - Intronic
1069616017 10:69806529-69806551 GGCGCTGATGGGGGAAGAGCTGG - Intronic
1069744844 10:70708619-70708641 GGGCCTGGTGGGGGACCAGCTGG + Exonic
1070162851 10:73876198-73876220 TGTCTTGATGGGGGACAAACAGG + Intergenic
1070977618 10:80617867-80617889 GGGGCTGTTGAGAGACAAGCAGG - Intronic
1071817932 10:89251795-89251817 GGTGCGGATAGGGGACCTGCAGG + Exonic
1072232545 10:93425574-93425596 GGGGCTGTTTGGGGACAAGATGG + Intronic
1072415855 10:95246218-95246240 GGTGCTGATGAGGAACTACCAGG + Intronic
1072722609 10:97790016-97790038 GGTGCTGCTGGGGTACAGGAGGG + Intergenic
1073515840 10:104074835-104074857 GGTGCTGGTGTTGGAGAAGCAGG - Intronic
1076096334 10:127737192-127737214 GGCGCTGCTGGCGGCCAAGCTGG + Intergenic
1076222498 10:128745759-128745781 GGTCCTGATAGGGGAGAAGGGGG + Intergenic
1076764811 10:132627275-132627297 GGGGCTGAGGGTGGACAGGCTGG + Intronic
1077886893 11:6393411-6393433 GGTGGTGCTGGGGGACAAGCAGG + Intronic
1078538695 11:12196278-12196300 CATGTTGATGGGGGAGAAGCAGG + Intronic
1079574247 11:21983599-21983621 AGTGCTGATGGGAGCCAAGAAGG - Intergenic
1080451308 11:32381136-32381158 GGTGCTGTTAGGGGACTGGCTGG - Intergenic
1080521197 11:33068954-33068976 GGTGCTGATGGGTGAGGAGATGG + Intronic
1082816824 11:57514819-57514841 GGGGCTGGAGGGGGGCAAGCGGG - Intronic
1082941125 11:58706615-58706637 GGTGCTGTTGGGGGGCATGGTGG + Intronic
1083148386 11:60774909-60774931 GGTGGAGAGGGTGGACAAGCGGG + Intronic
1083573144 11:63770383-63770405 GATGCTGATGGGTGCCACGCAGG + Intergenic
1083624234 11:64063882-64063904 GGTGGTGGAGGGGGACCAGCCGG + Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1083721285 11:64604819-64604841 TGAGCAGTTGGGGGACAAGCAGG + Intergenic
1088175026 11:107043661-107043683 AGTGATGATGTGGGAGAAGCTGG - Intergenic
1088387517 11:109275826-109275848 GGTGTTGTTGGGGGACATGTTGG - Intergenic
1088709945 11:112499101-112499123 GGTGGTTGTGGGGGACACGCAGG + Intergenic
1091346408 11:134857175-134857197 GGTGCAGAGGGAGGACAAGGGGG - Intergenic
1091604189 12:1936231-1936253 AGAGATGCTGGGGGACAAGCAGG - Intergenic
1091664141 12:2406983-2407005 AGTGCTGATGGGGGCCGAGTGGG - Intronic
1091807832 12:3368197-3368219 GGTGATGGTGGGAGACAGGCAGG + Intergenic
1092913504 12:13169007-13169029 GGAGGTGTTGGGGGACAACCAGG - Intergenic
1093388643 12:18589940-18589962 AGTGCTGATGGGGTACAGGCAGG - Intronic
1095246812 12:39932892-39932914 GGAGAAGATGGGGGACAAGCAGG + Intronic
1095969648 12:47892720-47892742 GGTGGGGATGGGGGACAAACAGG + Intronic
1096467156 12:51852978-51853000 GGGGCTGAAGGGAGAGAAGCAGG - Intergenic
1096573905 12:52540794-52540816 GGGGCTGCTGGGGGTCAAGCCGG - Intergenic
1096790119 12:54039259-54039281 GGTGCTGTTGGGGGATGAGGAGG + Intronic
1097173112 12:57128451-57128473 GGGGCTGATGGGGGAGAGGGAGG - Intronic
1097263737 12:57734288-57734310 GGAGGTGGTGGGGGACAGGCTGG - Intronic
1098544635 12:71698207-71698229 GGTGATGATGGGGGATAGGATGG - Intronic
1099296938 12:80840090-80840112 GGTACTGATGGGAGAGAGGCAGG - Intronic
1099962995 12:89414507-89414529 GGGGCTTATGGAGGACAACCTGG + Intergenic
1106483575 13:30154639-30154661 GGTGGTGACGGGGGAGATGCAGG - Intergenic
1107450798 13:40507269-40507291 GGTCCTGGTGGGTGGCAAGCAGG + Intergenic
1110119813 13:71866715-71866737 GGGGTTGAGGGGGGACCAGCTGG + Exonic
1110561831 13:76917901-76917923 GGGGCTGATAAGGGACACGCAGG + Intergenic
1110705462 13:78599040-78599062 GGTGTTGAAGGGGGACAAAAAGG - Exonic
1113106306 13:106775217-106775239 AGTGCTGTTGGGGGACAAGCGGG - Intergenic
1113743003 13:112724178-112724200 GGTGCCGATGGGGGCGAAGAGGG - Intronic
1121865487 14:97358997-97359019 GGTGATGCAGGGGGACAGGCAGG + Intergenic
1122353569 14:101111028-101111050 TTGGCTGGTGGGGGACAAGCAGG + Intergenic
1122601879 14:102925559-102925581 GGAGCTGATGGGGGACCTGTGGG + Intronic
1122863208 14:104591734-104591756 GCTGCTGATGGTGGACAGGGTGG + Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1123681755 15:22768878-22768900 GGAGCAGATGGGGGAGAAGGAGG - Intergenic
1124220562 15:27846845-27846867 GGTGAGGATGGGGGGCAAGTGGG + Intronic
1127006516 15:54576717-54576739 TGTGCTGGTGGGGGACAAGAGGG - Intronic
1128468257 15:67930555-67930577 CCTGCTGATGGGGAACAAGCTGG + Intergenic
1128764617 15:70243563-70243585 GGTGCTGGTGGGTGAGAAGCAGG + Intergenic
1129920999 15:79319083-79319105 GGTACTCATGGGGGACAAATAGG + Intronic
1130014246 15:80174924-80174946 GGTGCTGCTGGGGGCCTGGCTGG + Intronic
1131092629 15:89633862-89633884 GGTGCTGAAGGAGAAGAAGCAGG - Exonic
1131694181 15:94856870-94856892 GGTGAAGCTGGGGGAGAAGCGGG + Intergenic
1132727057 16:1343453-1343475 GGGGCTGCTGGAGGACATGCAGG + Exonic
1132941803 16:2512230-2512252 GGTGCAGGTGAGGGACAAGACGG + Intronic
1133344766 16:5062485-5062507 GGGGATGCTGGGGGAGAAGCTGG - Exonic
1136354595 16:29735928-29735950 GGTGCTGATGGGGGGCAGAAAGG + Intergenic
1137531278 16:49280455-49280477 GGTGGGGATTGGGGACAAGTGGG + Intronic
1137905859 16:52321289-52321311 TGTGCTGAAGGTGGAGAAGCAGG + Intergenic
1139420575 16:66847153-66847175 GGTGATGCTGAGGGACATGCAGG - Exonic
1139510258 16:67424134-67424156 GGGGCTGGTGGGGGAGAGGCGGG - Intergenic
1140493192 16:75358615-75358637 GGTGTTCATGGGGGAAAAGTAGG - Intronic
1141952595 16:87348421-87348443 CGTGATGATGGGGGAGAAGGTGG + Intronic
1142052370 16:87967064-87967086 GGGGCTGCTGTGGGACAGGCTGG + Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1144081702 17:11769232-11769254 GGTGCTGGTGGGAGCTAAGCTGG + Exonic
1144761712 17:17710937-17710959 GGTGTTGATGGGGGGCAGGTGGG + Intronic
1144961553 17:19047055-19047077 GCTCCTGATGGGGGAGAAACAGG + Exonic
1144973607 17:19127469-19127491 GCTCCTGATGGGGGAGAAACAGG - Exonic
1145125022 17:20292947-20292969 GGTGCTTTTGGGGGACATTCTGG + Intronic
1145193732 17:20868957-20868979 GGAGGTGATGGGGGAAAAGGGGG + Intronic
1147542615 17:41373291-41373313 GCTTCTGATAAGGGACAAGCAGG + Intronic
1147791986 17:43019791-43019813 GGTGCTGTTCTGGGACAATCTGG + Intronic
1147795059 17:43036412-43036434 TGTCCTGATGAGGGACGAGCAGG + Intergenic
1149595937 17:57864721-57864743 GGAGCTGGAAGGGGACAAGCTGG + Intronic
1149602146 17:57899938-57899960 GGTGCAGATGGGGGAAGAGAGGG - Intronic
1150386752 17:64767563-64767585 GGAGCTGAGGGGGGCCAAACAGG + Intergenic
1151454493 17:74217924-74217946 GGTGTTGCTGTGGGACAAGGAGG + Intronic
1151560456 17:74866873-74866895 GGTGCTGCTGGGGAACAGGGTGG + Exonic
1152132511 17:78485625-78485647 GGTGCTGATGGGGGACAAGCTGG - Exonic
1152618460 17:81348734-81348756 CGTGCTGCTGATGGACAAGCAGG + Intergenic
1155207212 18:23570563-23570585 GGTGGTGATAGGGCACAAGTTGG - Intronic
1156466531 18:37351102-37351124 GGTGCTGGTGGGGGAGAGGGGGG + Intronic
1159000594 18:62971539-62971561 GGGGCTGAAGGAGGACAAGGTGG - Intronic
1159523229 18:69553682-69553704 GCTTCTGAAGGGAGACAAGCTGG - Intronic
1159801747 18:72908707-72908729 AGTGCTGATGGTGAACAAGGTGG + Intergenic
1159809301 18:72997245-72997267 GGTTCTGATGAGAGACAAGGTGG - Intergenic
1160680395 19:409328-409350 GGGGCCGGTGGGAGACAAGCAGG + Intergenic
1160795075 19:941441-941463 GGTGCTGGCTGGGGACACGCAGG - Intronic
1160861154 19:1237706-1237728 GGGGCGGACGGGGGACAGGCCGG - Intronic
1160932778 19:1578471-1578493 GGCGCTGATGGCCGACATGCTGG - Exonic
1160975772 19:1791750-1791772 GGTGCTCACCGGGGACAAGCAGG - Exonic
1161619404 19:5290421-5290443 GGTGCTAATGGGGGGCGAGTGGG + Intronic
1161839393 19:6669916-6669938 GTTGCTGATGGGGGCCGGGCTGG - Exonic
1162760794 19:12887102-12887124 TGTGCTGATGGAGGGCAAGGCGG + Exonic
1162834657 19:13308358-13308380 GGTGGGGATGGGGGACATGGTGG - Intronic
1163826419 19:19527178-19527200 GGTGCTGCTGGGGGAAGAGGCGG - Intronic
1164768063 19:30786995-30787017 TGTACTGATGGGGGCCAAGGAGG + Intergenic
1165006840 19:32814309-32814331 GGAGCTCTTGGGGAACAAGCAGG - Intronic
1165712722 19:38023755-38023777 AGTGGTGATGGGGGACAGCCAGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166352090 19:42204076-42204098 GGTGGGGGTGGGGGACAAGAGGG - Intronic
1166364324 19:42270741-42270763 GGTGCTGTGGGGGGAGGAGCAGG + Intronic
1168643680 19:58046272-58046294 GCTGCTGAAGGAGGACATGCAGG + Intronic
924990735 2:310716-310738 GATGCTTTTGGGGGACCAGCCGG + Intergenic
926161793 2:10494774-10494796 GACGCAGATGTGGGACAAGCAGG - Intergenic
928181256 2:29070623-29070645 GGTGCTGGTGGGGTCCAAGGTGG + Exonic
928453786 2:31401289-31401311 GGAGCAGATGGGGGCCAGGCAGG + Exonic
928950222 2:36807353-36807375 GGTGTGGATGGGAGACTAGCTGG - Intronic
929190999 2:39139594-39139616 GGTGGTGATGGGGGAGAGGGGGG - Intergenic
932443803 2:71758181-71758203 ATTGCTGTTGGGGGAAAAGCAGG + Intergenic
932686691 2:73876553-73876575 GGTGGTGATGGGGAAAAAGGGGG - Intergenic
933836945 2:86253485-86253507 GGTGGTGGTGGGGGACAGGCAGG - Intronic
936246789 2:110835530-110835552 GGTGCTCACGGGAGACCAGCAGG - Intronic
937990145 2:127657605-127657627 GGTGCAGATGGGGCACACGCGGG + Intronic
940209362 2:151240909-151240931 GGTGGTGATGTGGCACAAGGTGG - Intergenic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
943064419 2:183071345-183071367 GGAGCTGATGAACGACAAGCTGG - Intergenic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
947300295 2:228681901-228681923 GGTGCTGATGGGACAAAAGCTGG + Intergenic
948773985 2:240270641-240270663 GGAGTTGAGGGGGGACAAGATGG - Intergenic
948853528 2:240719713-240719735 TGTGCTGACAGGGGACAGGCAGG - Intronic
949035635 2:241814646-241814668 GGTGCTGAGGAGGGGCACGCTGG + Exonic
1170464719 20:16612099-16612121 AGAGCTGATGCTGGACAAGCCGG + Intergenic
1171240666 20:23565008-23565030 GGTGCTGATGGTGAAGAAGCAGG + Exonic
1173354278 20:42272513-42272535 GCTGCTGAAGGGGGCCAAGTGGG - Intronic
1174055479 20:47795321-47795343 GGTGCTGATCAGGACCAAGCTGG - Intergenic
1174058318 20:47815006-47815028 GGATCTGAGGTGGGACAAGCTGG + Intergenic
1174456050 20:50649577-50649599 GGTGGGGGTGGGGGACAGGCAGG - Intronic
1174587772 20:51622145-51622167 GATGCTGACAGGGGACAAGCTGG - Exonic
1175121077 20:56716849-56716871 GGTGGTGATGTGCGACATGCAGG + Intergenic
1176031922 20:63016964-63016986 GGTGCTGTCTGGGGACAGGCTGG + Intergenic
1176094311 20:63332976-63332998 GGGGCTGATGGGAGACGTGCAGG - Intronic
1176982247 21:15396861-15396883 TGTTGTGATGGGGGAGAAGCAGG + Intergenic
1181007238 22:20019732-20019754 GGTGGTGGTGGTGGACAAGTGGG - Intronic
1181270632 22:21656743-21656765 AGGGCTGATGGAGGACAAGGAGG + Intronic
1181853756 22:25768375-25768397 GTTGTTGATGGTGGCCAAGCTGG + Exonic
1182005074 22:26953016-26953038 TGTGGTAATGGGGGAGAAGCTGG + Intergenic
1182049803 22:27303972-27303994 GGCACTGATGTGGGACAAGATGG + Intergenic
1182074845 22:27488456-27488478 GGTGCTGGTGGGGGCCAGGGAGG + Intergenic
1182149447 22:28017990-28018012 AGTGCTGATGGGGCACAGGTGGG - Intronic
1183653258 22:39171101-39171123 GGTGCTGATGGTGGACGCTCAGG - Intergenic
1183675508 22:39296991-39297013 GGGGCTGGTGGGGAACAGGCGGG + Intergenic
1184152130 22:42645416-42645438 TGTGCTCTTGGAGGACAAGCGGG - Intronic
1184240098 22:43207403-43207425 GGTGGTGATGGGAGAGGAGCAGG - Intronic
1184375226 22:44107773-44107795 GGTGCTGGAGGGGGACACGCAGG + Intronic
1185100641 22:48839204-48839226 GATGCTGCTGGGGGTCATGCAGG - Intronic
1185377041 22:50487487-50487509 GGTGTGGATGGGGGAGAAGGGGG - Intronic
949948666 3:9211130-9211152 GGTGTTGAGGGGGGAGAAGTGGG + Intronic
950624675 3:14236158-14236180 GCTGCTGACATGGGACAAGCGGG - Intergenic
953388797 3:42522748-42522770 GGTGGTGCTGGGGAAGAAGCTGG + Intronic
954368111 3:50156711-50156733 GGAGCTGAAGGGGGAGCAGCAGG - Intronic
954870514 3:53764229-53764251 GGTGCTAATGGGAGAACAGCAGG + Intronic
961000618 3:123371771-123371793 GGTGGGGGTGGGGGACAATCAGG - Intronic
961168284 3:124778649-124778671 GGCGGAGATGGGGGACAAGGAGG + Intronic
961368638 3:126416405-126416427 GCTGCAGCTGGAGGACAAGCAGG + Exonic
961428451 3:126863930-126863952 GGTGGTGATGGTGGAGAAGGAGG - Intronic
961534869 3:127564149-127564171 GGTGCTGATGATGGTCATGCTGG - Intergenic
961551408 3:127672414-127672436 GGCGCTCATGGGGGGCAAGCGGG + Exonic
961643643 3:128380881-128380903 AGTGCTGGTGGGGGAGAGGCCGG - Intronic
965373500 3:167893344-167893366 GGAGCTGGTGGGGGATGAGCAGG + Intergenic
966007412 3:175032979-175033001 TGTGCTGATTGGGAAGAAGCAGG - Intronic
968605163 4:1531977-1531999 GCTGCTGATGGGGGACAGAGCGG - Intergenic
969347802 4:6580263-6580285 GGGGATGCAGGGGGACAAGCAGG - Intronic
969410307 4:7023967-7023989 GGTTCTGATGAGGGACAGCCTGG + Intronic
972567961 4:40285822-40285844 GGTGCTGACGGAGGACAAGCCGG + Intergenic
973206244 4:47563663-47563685 GATGCTGACAGGGGACAAGCAGG + Exonic
979002342 4:115239059-115239081 GGTGGTGATAGGGCATAAGCGGG - Intergenic
985392019 4:189499902-189499924 AGTGGGAATGGGGGACAAGCTGG + Intergenic
986903717 5:12468161-12468183 GGTACTGATGGGGGTGGAGCTGG - Intergenic
988702016 5:33685124-33685146 GGTGCAGATGAGGGAGAGGCAGG - Intronic
997294612 5:132761836-132761858 GGTGAAGGTGGGGAACAAGCTGG - Exonic
997364293 5:133315762-133315784 GGTCCTGATGGTAGAAAAGCTGG - Intronic
997579677 5:135009418-135009440 GATGCTCATGGGAGAGAAGCAGG + Exonic
998134785 5:139668883-139668905 GGTGCTGATGGTTTACAAACGGG - Intronic
998380055 5:141717864-141717886 GGTGGTGATGGGGGAGGAACAGG + Intergenic
999041977 5:148424096-148424118 GATGTTGATGAGGAACAAGCAGG + Exonic
1002063923 5:176642885-176642907 GGTGCTGGTGGGTTAAAAGCTGG + Intronic
1002352074 5:178590233-178590255 GGTGCTGCTGGGGCAGAGGCTGG + Exonic
1002640800 5:180629767-180629789 GCTGCTGGTAGGGGAGAAGCTGG - Exonic
1003606528 6:7566439-7566461 GATGCTGATTGAGGACAAGTTGG - Exonic
1003619169 6:7682638-7682660 AGTGTTGATGGGAGACAAGAGGG + Intergenic
1004393360 6:15227597-15227619 GGTGCTTTGGGGGGACAAGCGGG + Intergenic
1007782333 6:44261773-44261795 GGTGCTGAAGGGGGCCAGCCGGG - Exonic
1008332349 6:50260073-50260095 GGTGCTGGTGGGGGTCTGGCTGG + Intergenic
1013155861 6:107490510-107490532 GGTGCTGATGGTGGCGAGGCTGG - Exonic
1015196571 6:130530033-130530055 AGTGCTGATGGGGGACACGGTGG + Intergenic
1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG + Intronic
1018752232 6:166817194-166817216 GGTGCTAAGGGGGGAGCAGCAGG - Intronic
1019265689 7:116377-116399 GGTGCAGGTGGGGCACAGGCTGG - Intergenic
1019614738 7:1954100-1954122 GGTTCTGATGGGCCACATGCGGG - Intronic
1021943797 7:25705289-25705311 GGTGGGGATGGGGGAGAAGGAGG + Intergenic
1022612951 7:31895295-31895317 GGAGCTGAACAGGGACAAGCTGG + Intronic
1022793752 7:33715076-33715098 GGAGCTGCTGGAGGAGAAGCAGG - Intergenic
1025237507 7:57244810-57244832 GGTGCTGATCAGGACCAAGCTGG + Intergenic
1026114272 7:67483205-67483227 GGTGGTGATGGGGGAAGACCTGG - Intergenic
1029104806 7:98166157-98166179 AGTGCTGATGGAGGAAATGCAGG - Intronic
1029676889 7:102075990-102076012 GGGGATGGTGGGGGATAAGCTGG - Intronic
1031507680 7:122606735-122606757 GGTGCTAATGGGGAAAAAGAAGG + Intronic
1033586720 7:142779762-142779784 TGTGCTGATGTGTGACACGCTGG + Intergenic
1034026255 7:147707922-147707944 GGTGCTGATGGTGGTCAACTTGG + Intronic
1034278382 7:149834557-149834579 GGTGATGTTGAGGGACAAACGGG - Intergenic
1035496355 7:159330568-159330590 GGTGCTGAGCAGAGACAAGCAGG - Intergenic
1035616953 8:1009056-1009078 GGCCCTGATGGGGGGCAGGCAGG + Intergenic
1035750986 8:1996161-1996183 GGTGCTGATGGAGGCCATGTGGG + Intronic
1035759308 8:2057616-2057638 GGGGCAGATGGAGGACAAGCTGG + Exonic
1035962527 8:4153526-4153548 GCTGCTGACGAGGGACCAGCTGG - Intronic
1036645742 8:10610815-10610837 GGCGCTGATGGGCTCCAAGCAGG - Exonic
1039481189 8:37874720-37874742 CATGCTGATGGGGGTTAAGCCGG - Exonic
1039960066 8:42239392-42239414 GGAGGGGATGGGGGCCAAGCAGG - Intergenic
1040448803 8:47523615-47523637 GCTGGTGATGGGGGTCAGGCTGG + Intronic
1040981559 8:53250957-53250979 GCTGCTGTTGGGGGGCAGGCAGG + Exonic
1043840355 8:85095111-85095133 GGTGGTGATGAGGGAGAAGAAGG - Intergenic
1047241525 8:123093993-123094015 GGTTCTGATGGAGGAAAGGCTGG - Intronic
1047901906 8:129431948-129431970 GGTGCTGTTGGGGGGCATGGTGG - Intergenic
1049206210 8:141364833-141364855 GGGGCTGGTGGGTGACACGCAGG - Intronic
1049924948 9:399964-399986 GGTGGTGATGGTGGAGAAGGTGG - Intronic
1050781046 9:9336456-9336478 GGTGATGATGGTGGACAGGCTGG + Intronic
1053086564 9:35228673-35228695 TGTGTTGCTGGGGGAAAAGCAGG - Intronic
1054787788 9:69225457-69225479 GGTGCTGAATGTGGACATGCAGG - Intronic
1056847533 9:90053858-90053880 GGTGCAGACAGGGGTCAAGCAGG - Intergenic
1057890219 9:98864330-98864352 GGAGGTGAGGGGGGCCAAGCTGG + Intergenic
1060059749 9:120448502-120448524 GGTGGTTCTGGGGGACTAGCAGG - Intronic
1060661473 9:125407725-125407747 GGTGGTGCTGGGAGACGAGCAGG + Intergenic
1061273453 9:129556960-129556982 GGTGGTGATGGAGGTCAGGCTGG + Intergenic
1062170742 9:135133386-135133408 GGCTCGGGTGGGGGACAAGCTGG + Intergenic
1062454456 9:136629111-136629133 GGGGCTGCTGGGGGCCAAGGAGG - Intergenic
1062592184 9:137279205-137279227 GGCGCTGATGCGGGACTACCTGG + Exonic
1185609667 X:1386973-1386995 GGTGGAGATGGGGGACACCCAGG - Intronic
1186900051 X:14044578-14044600 AATGATGATGGGGGACAAGATGG + Intergenic
1187369464 X:18692675-18692697 GGTGATGAATGGGGAAAAGCAGG - Intronic
1189051696 X:37652143-37652165 AGTGCTGATGGGGGAGGGGCAGG + Intronic
1189242497 X:39536443-39536465 TGTGCTGATGGAGGGGAAGCGGG - Intergenic
1198734905 X:139774871-139774893 GGTGCTCACTGGGGACAAGATGG - Exonic
1200921200 Y:8615105-8615127 AGTGCTGTTGGGGGACAATGTGG - Intergenic