ID: 1152136121

View in Genome Browser
Species Human (GRCh38)
Location 17:78504717-78504739
Sequence GCCGGGGGACGCGCTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152136108_1152136121 15 Left 1152136108 17:78504679-78504701 CCCGGAAGTTTTCTGACGGCAGA 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1152136109_1152136121 14 Left 1152136109 17:78504680-78504702 CCGGAAGTTTTCTGACGGCAGAA 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152136121 Original CRISPR GCCGGGGGACGCGCTTGCTG GGG Intronic
900016071 1:151016-151038 GCCCTGGGACGCTATTGCTGGGG - Intergenic
900046335 1:509610-509632 GCCCTGGGACGCTATTGCTGGGG - Intergenic
900068536 1:751322-751344 GCCCTGGGACGCTATTGCTGGGG - Intergenic
900166613 1:1246538-1246560 GCGGGAGGACGCGCTGGCGGTGG + Exonic
900187931 1:1341729-1341751 GGCGGTGGACGCGCTGTCTGGGG + Exonic
902241654 1:15094133-15094155 GCTGGGGGACGAGGCTGCTGGGG - Intronic
903664434 1:24997763-24997785 GCCTAGAGACGTGCTTGCTGGGG - Intergenic
904837562 1:33349335-33349357 GCCTGGGGACGCGGAAGCTGCGG + Intronic
906250085 1:44304533-44304555 GCCTAGTGACGTGCTTGCTGCGG - Intronic
922103892 1:222496694-222496716 GCCCTGGGACGCTATTGCTGGGG - Intergenic
922264213 1:223969225-223969247 GCCCTGGGACGCTATTGCTGGGG - Intergenic
923490367 1:234478737-234478759 GCTGGCGGCCGCGCTGGCTGAGG - Exonic
924303716 1:242665699-242665721 GCTGGGGAAAGCCCTTGCTGGGG + Intergenic
1062843667 10:689346-689368 TCCGGGGGACGCGCACGCTCCGG + Intronic
1066730284 10:38430602-38430624 GCCCTGGGACGCTATTGCTGGGG + Intergenic
1076710616 10:132331922-132331944 GCGGGGGGTTGCGCTTGCGGTGG - Intergenic
1076837201 10:133027140-133027162 GCCTGGGGACCAGCTTGCCGTGG + Intergenic
1076972661 11:146083-146105 GCCCTGGGACGCTATTGCTGGGG - Intergenic
1077341321 11:2027652-2027674 GCCCGGGGCCGGGCTTGCAGGGG + Intergenic
1077360605 11:2138851-2138873 GCCGGGGGAGGCGGTGACTGGGG + Intronic
1080107456 11:28525842-28525864 GCAGGGGGCGGCGCTTGTTGGGG + Intergenic
1080638631 11:34145134-34145156 GCCGGGGAGCATGCTTGCTGTGG + Intronic
1081969205 11:47186456-47186478 GCCGGGGGCCGGGCTTCCCGGGG - Intergenic
1082002369 11:47400253-47400275 GCCGGGGGCCGGGCCTGCGGCGG - Intergenic
1082252231 11:49995253-49995275 ACCAGGGGACAAGCTTGCTGGGG + Intergenic
1082555604 11:54559620-54559642 ACCAGGGGACAAGCTTGCTGGGG - Intergenic
1083460114 11:62805525-62805547 GCAGGGGGCCGCGCTTTCTCCGG - Exonic
1083477319 11:62922832-62922854 GCGGGGGGCGGCGCTTGGTGGGG - Intergenic
1083748158 11:64746290-64746312 GCCGTGGGACGCACCTGCCGAGG + Intergenic
1084021366 11:66420112-66420134 GCGGGGGGAAGCGCTCGCTTGGG + Intergenic
1084603420 11:70159687-70159709 GGCAGGGGACGCGCCCGCTGGGG + Intronic
1089262500 11:117232516-117232538 GCCGGGGCACGGGGATGCTGCGG - Exonic
1090056857 11:123431079-123431101 GCGCGGGGACGCGCTGGGTGTGG - Exonic
1202824306 11_KI270721v1_random:82841-82863 GCCCGGGGCCGGGCTTGCAGGGG + Intergenic
1095829480 12:46569330-46569352 GCCTGGGGGCGTGTTTGCTGGGG + Intergenic
1096524875 12:52204536-52204558 TCCAGGGGAAGCGCCTGCTGCGG + Intergenic
1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG + Exonic
1103976608 12:124706703-124706725 GCAGGGGGACGCGCCTTCTGGGG + Intergenic
1113799502 13:113079023-113079045 GCGGGTGGAGGCTCTTGCTGGGG - Intronic
1117302560 14:54443367-54443389 GCAGGGGGTGGCGCTCGCTGGGG - Intergenic
1118808927 14:69260059-69260081 CCCGGGGGACGCGCGCGCTCGGG + Exonic
1119383018 14:74240503-74240525 GCCCGGGGACGCGCGGGCTCGGG + Intronic
1122784721 14:104158399-104158421 CCCGGGGGAGGCGCAGGCTGGGG + Intronic
1122922852 14:104887074-104887096 GCCGGAGGACGCCCTGTCTGGGG + Exonic
1127763582 15:62164477-62164499 GCCCCAGGACGCGCTCGCTGCGG - Exonic
1138591192 16:58000550-58000572 GGCGGGGGACGGGCTAGCGGCGG + Intronic
1139967659 16:70754621-70754643 GCCCGGGGACCCTCTTCCTGAGG - Intronic
1140528996 16:75648080-75648102 GCCCGGGGAGGCGCTGGCCGAGG + Exonic
1141731314 16:85824949-85824971 GCCGGGGGGCACGCTGTCTGCGG + Intergenic
1142447588 16:90151439-90151461 GCCCTGGGACGCTATTGCTGGGG + Intergenic
1142459905 17:83884-83906 GCCCTGGGACGCTATTGCTGGGG - Intergenic
1142553048 17:752525-752547 CCCGGGGGAGGCGCTCGGTGGGG - Intronic
1145991269 17:29080725-29080747 ACCGGGGGGCGCGCTGGCCGGGG - Intronic
1150795158 17:68230756-68230778 GCCAGGGGAAGTGCTTGGTGAGG - Intergenic
1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG + Intronic
1155508234 18:26550964-26550986 CCCGGGGGCCGCGCTGGCTCCGG + Intronic
1160649620 19:216392-216414 GCCCTGGGACGCTATTGCTGGGG - Intergenic
1167040308 19:47019864-47019886 GCAGCGGGACGCGCGGGCTGTGG - Exonic
929266657 2:39925978-39926000 GCAGGGGGTCACGCATGCTGGGG + Intergenic
930798699 2:55420048-55420070 GCCCGGGGGCGCGCTCGCTCGGG - Intergenic
936427795 2:112435019-112435041 GCAGGGGGAGCCACTTGCTGGGG - Intergenic
937942016 2:127293625-127293647 GCCGAGGGAACCGCTTCCTGAGG + Exonic
939972501 2:148678445-148678467 GCAGGGGGTGGCGCTTGTTGAGG + Intronic
941178966 2:162235230-162235252 GCAGGGGGAAGTGCTTGTTGGGG - Intronic
948803229 2:240442149-240442171 GCCGGAGGAGGCGGGTGCTGTGG - Intronic
949000553 2:241610546-241610568 GCCGAGGGGCGCGGTCGCTGTGG - Intronic
1171173645 20:23035597-23035619 GCCCGGGGACGCGCGGGCGGCGG + Exonic
1174357801 20:50010024-50010046 GCCTGGCGACGCGCTGTCTGCGG - Intergenic
1176095909 20:63344543-63344565 GCCGGGGGACCCTCCTGCCGGGG - Exonic
1176374449 21:6080192-6080214 GCAGGGGGAGCCACTTGCTGGGG + Intergenic
1179749026 21:43458053-43458075 GCAGGGGGAGCCACTTGCTGGGG - Intergenic
1179833293 21:44012000-44012022 GCCGCGGGACGCCCGAGCTGCGG + Intergenic
1181437047 22:22917160-22917182 GTCAGGGGAGGCGCTTGCTGTGG + Intergenic
1182137402 22:27918996-27919018 GCCGAGGGGCGCACTCGCTGAGG + Intronic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
951332909 3:21387296-21387318 GCAGGGGGTGGCGCTTGTTGAGG + Intergenic
952818940 3:37469189-37469211 GCCGGGGGATGCTCCTGCTGGGG + Intronic
953307564 3:41844213-41844235 GCAGGGGGCGGCGCTCGCTGGGG + Intronic
954035781 3:47850302-47850324 GCTGGGGAACGGGCTGGCTGTGG + Intergenic
954226159 3:49182709-49182731 GCAGGGGGCGGCGCTTGTTGGGG + Intronic
954778974 3:53045659-53045681 GCCGGCGGGCGCGCGGGCTGAGG - Intronic
960047528 3:113212133-113212155 GCCGGGGGACGTGCCGGCGGCGG + Intronic
968323472 3:197791599-197791621 GCCGGGGGAGGCGGATGCGGGGG + Intronic
968368229 3:198203739-198203761 GCCCTGGGACGCTATTGCTGGGG + Intergenic
969666570 4:8560723-8560745 GCCGGGGGAGGAGCTGTCTGGGG + Intronic
971280490 4:25239286-25239308 GCAGGGGGTGGCGCTTGTTGGGG + Intronic
972392601 4:38627219-38627241 GCAGGAGGCGGCGCTTGCTGGGG - Intergenic
978997999 4:115179475-115179497 GCAGGGGGTGGCGCTTGTTGGGG + Intergenic
979256657 4:118613467-118613489 GCCCTGGGACGCTATTGCTGGGG + Intergenic
979331691 4:119427078-119427100 GCCCTGGGACGCTATTGCTGGGG - Intergenic
981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG + Intronic
981429843 4:144646007-144646029 CCCGGGGGACGCGCTCGCGCGGG + Exonic
983904621 4:173169740-173169762 GCCTGGGGAAGCCCCTGCTGTGG + Intronic
984728695 4:183045382-183045404 GCAGGGGGCAGCGCTTGTTGGGG - Intergenic
986330329 5:6712931-6712953 GGCGGGGGAAGCGCCTGCGGTGG + Intergenic
1002727450 5:181308970-181308992 GCCCTGGGACGCTATTGCTGGGG + Intergenic
1007702059 6:43771344-43771366 GCCGGGAGAGGCGCTCGCAGCGG - Intronic
1009407062 6:63326494-63326516 GCAGGGGGTGGCGCTTGTTGAGG + Intergenic
1011663283 6:89612316-89612338 GCAGGAGGACGCGCGTGCTCTGG - Exonic
1019480330 7:1263793-1263815 TGCGGGGGACGCGCTGCCTGCGG - Intergenic
1026481412 7:70782876-70782898 CCAGGGGGACGCACTTGCTTTGG - Intronic
1032048969 7:128634233-128634255 GCCCTGGGACGCTATTGCTGGGG + Intergenic
1032306271 7:130734294-130734316 GCCGGGGGCCGCGCGTTCCGAGG - Intergenic
1034313582 7:150110745-150110767 GCAGGGGGCGGGGCTTGCTGGGG + Intergenic
1034435071 7:151059577-151059599 GCCGGGGGGCGCGCACGCAGGGG + Intronic
1034793314 7:153990051-153990073 GCAGGGGGCGGGGCTTGCTGGGG - Intronic
1036652440 8:10653998-10654020 GCAGGGGGATGAGCTGGCTGTGG + Intronic
1038002627 8:23404206-23404228 GCCGGAGGCCGGGCCTGCTGCGG - Exonic
1044819324 8:96145155-96145177 TCCGGGGGCGGCGGTTGCTGGGG + Exonic
1049556204 8:143283485-143283507 GCCGTGGGACGCCCCTGCTTGGG + Intergenic
1049799153 8:144509765-144509787 GCTGGGGGCCGCGCTAGCTGGGG + Exonic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059561443 9:115338591-115338613 TCTGGGGGACAGGCTTGCTGAGG - Intronic
1061303568 9:129720152-129720174 GCGGGGAGAGGCGCTTGCTGAGG - Intronic
1061303573 9:129720179-129720201 GCGGGGAGAGGCGCTTGCTGAGG - Intronic
1062158492 9:135067097-135067119 GCCGGGGGAGACTCATGCTGGGG + Intergenic
1062158567 9:135067391-135067413 GCCGGGGGAGACTCATGCTGGGG + Intergenic
1062431050 9:136527023-136527045 TCCGTGAGACGCGCTAGCTGGGG + Intronic
1062752570 9:138266444-138266466 GCCCTGGGACGCTATTGCTGGGG + Intergenic
1203575085 Un_KI270745v1:1219-1241 GCCCTGGGACGCTATTGCTGGGG + Intergenic
1186479125 X:9882692-9882714 GGCGGGGCACGCTCTTGCTAGGG + Intronic