ID: 1152138100

View in Genome Browser
Species Human (GRCh38)
Location 17:78517787-78517809
Sequence CAGTTGTAAGAGAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152138100_1152138103 14 Left 1152138100 17:78517787-78517809 CCAGCTTCTCTCTCTTACAACTG 0: 1
1: 0
2: 1
3: 51
4: 535
Right 1152138103 17:78517824-78517846 TATCACAACAAACAAGACCATGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152138100 Original CRISPR CAGTTGTAAGAGAGAGAAGC TGG (reversed) Intronic
900957637 1:5897021-5897043 CAGTTTTCAGAGTGAGAAGTCGG - Intronic
901583732 1:10268456-10268478 AAGTTGTAAGATAGAGAATAGGG + Intronic
902550756 1:17218181-17218203 CAGTTGCAAGAGAGGGCATCTGG + Intronic
902694869 1:18133450-18133472 CATTTGTCAGATGGAGAAGCGGG - Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
904912974 1:33949308-33949330 GAGCTGAAAAAGAGAGAAGCCGG + Intronic
905032639 1:34897869-34897891 GAGTTGTGAGAGAGAGAAAGTGG + Intronic
905042431 1:34971144-34971166 GAGAAGCAAGAGAGAGAAGCAGG - Intergenic
905086724 1:35386420-35386442 CAAGAGGAAGAGAGAGAAGCGGG + Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905747040 1:40426979-40427001 CAGTTGTAAAGTAGAGAAACAGG + Intergenic
906353544 1:45083867-45083889 CAGGAGGAAGAGAGAGAAGTGGG + Intronic
906835382 1:49078193-49078215 GAGTAGGAGGAGAGAGAAGCAGG + Intronic
907793383 1:57690443-57690465 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
907870540 1:58438846-58438868 CAGGTGAAAGCGACAGAAGCAGG - Intronic
907980330 1:59474063-59474085 CAGTTGGAACAGAGTGATGCAGG - Intronic
908381511 1:63601441-63601463 CACTTCTAAGAAAGTGAAGCAGG + Intronic
908809422 1:67964650-67964672 CAGGAGGAAGAGAGAGAAGGTGG - Intergenic
909099790 1:71336311-71336333 CAGTTGAAAGAGGGCCAAGCAGG + Intergenic
909382046 1:75009878-75009900 CAGGAGGAAGAGAGAGAAGTAGG - Intergenic
909819747 1:80047028-80047050 CAGTTCCAGGGGAGAGAAGCAGG - Intergenic
910650127 1:89557655-89557677 CACTAGTGAGAGTGAGAAGCAGG - Intronic
910891393 1:92024104-92024126 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
914406324 1:147377327-147377349 CAGTTGTAAGGAAGATAAGCTGG + Intergenic
915033663 1:152905144-152905166 AAGATGTAAGAGAGGAAAGCAGG + Intergenic
915986717 1:160473361-160473383 CAGTAGCTAGAGAGAGAAGTGGG + Intergenic
916527310 1:165622814-165622836 CAGATGAGAGAGAGAGAAGGAGG - Intergenic
916699090 1:167272601-167272623 CAGGAGGAAGAGAGAGAAGTAGG + Intronic
916829114 1:168473342-168473364 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
917156606 1:172006628-172006650 AAGTTGAAAGAGACAGAAGAAGG - Intronic
917567312 1:176226108-176226130 CACTTGGAAGAGAGCCAAGCAGG - Intergenic
918039146 1:180901655-180901677 CAGCTGTAAGAGAAGGAGGCAGG + Intergenic
918645278 1:186897003-186897025 AGGTTGTAAGAGAGAGAAGTTGG + Intronic
920298734 1:204975636-204975658 GAGGTGTAGGAGAGAGAAGCAGG - Intronic
920870152 1:209787345-209787367 CACTAGTAAGGGAGACAAGCAGG + Exonic
921148548 1:212381914-212381936 CTGTTCTCAGAGAGAGAAGGAGG + Intronic
922059330 1:222072766-222072788 CAGATATACCAGAGAGAAGCTGG - Intergenic
922475771 1:225906114-225906136 CATTTTAAAGAGAGAGAAACTGG + Intronic
922652514 1:227353489-227353511 AAGTAGGAAGAGAGAGCAGCGGG - Intergenic
923522099 1:234743080-234743102 CCCTAGCAAGAGAGAGAAGCAGG - Intergenic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
924177020 1:241401374-241401396 CAGGAGGAAGAGAGCGAAGCGGG + Intergenic
924440768 1:244083398-244083420 CTGTTGAAAGAGAAAGAAGTGGG - Intergenic
924846172 1:247774703-247774725 CAGCTGTAAGAGAAAGAAATGGG - Intergenic
1063177912 10:3568808-3568830 CATTTGTAAGAGGAAGAAGAAGG - Intergenic
1065349610 10:24783652-24783674 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1065534851 10:26706973-26706995 CACTTGTAAGAGGGCCAAGCTGG + Intronic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1065835417 10:29653303-29653325 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1067084838 10:43232310-43232332 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068763675 10:60739153-60739175 CATTAGCAAGAGAGAAAAGCTGG + Intergenic
1069548155 10:69343481-69343503 CAATTCTCAGAGAGAGAAGGAGG + Intronic
1070976331 10:80608834-80608856 CAGTGAACAGAGAGAGAAGCTGG - Intronic
1071119588 10:82261967-82261989 CAGGAGTAAGAGAAAGAAGGGGG - Intronic
1071476913 10:86033069-86033091 CAGCTAGAAGACAGAGAAGCTGG + Intronic
1073370320 10:102982520-102982542 AATTTGCAGGAGAGAGAAGCTGG + Intronic
1073654578 10:105399332-105399354 CAGTTTTAAGTGACAGAAGTAGG + Intergenic
1073664601 10:105516571-105516593 CAGGTCTAAAAGAGAGAAGCAGG + Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1074270019 10:111944718-111944740 GAGTTGCCAGAGGGAGAAGCAGG + Intergenic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1076499747 10:130928364-130928386 GAGCTGTAGGAGAGAGAGGCTGG + Intergenic
1076869380 10:133185971-133185993 CAGATGTCAGCGAGAGCAGCTGG + Exonic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078646745 11:13147820-13147842 CAGGAGCAAGAGAGAGAAGGAGG + Intergenic
1079471988 11:20787048-20787070 CACTTGCAAGAGAGCCAAGCAGG + Intronic
1079992027 11:27256270-27256292 CAGGAGAAAGAGAGAGAAGTAGG + Intergenic
1080079093 11:28193390-28193412 CAGGAGGAAGAGAGAGAAGGTGG + Intronic
1082026694 11:47578005-47578027 CAGCTGGCAGAGAGAGAAGTTGG - Exonic
1083330536 11:61896388-61896410 CAGATGGAAGAGAGGAAAGCAGG - Intergenic
1085046217 11:73355235-73355257 CAGTTGGAAGTGAGAGAACCAGG + Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085683064 11:78596094-78596116 CACTTGGAAGAGGGACAAGCGGG - Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1086764451 11:90676784-90676806 CAGCAGCAAGAGAGAGGAGCTGG - Intergenic
1086794749 11:91085581-91085603 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1087859267 11:103133353-103133375 TAGTTGTAAAAGGGAGAAGCTGG + Intronic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089719828 11:120405388-120405410 CATTTAAAAGAGAGAGAACCAGG + Intronic
1090027272 11:123178672-123178694 CATTTGTAAAAGAGAAGAGCAGG + Intronic
1090638749 11:128712213-128712235 CAGGAGCAAGAGAGAGAAGGAGG - Intronic
1090960303 11:131550510-131550532 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1091336365 11:134770621-134770643 CAGATGAAAGAGAGTAAAGCTGG + Intergenic
1091420673 12:337126-337148 CAGGAGGAAGAGAGAGAAGCGGG - Intronic
1091528180 12:1327555-1327577 CAGTTGTAAGGGAGAGAAAAAGG - Intronic
1091721587 12:2817889-2817911 CAGCTGTAAGAGAGAAAGGGAGG - Exonic
1093425036 12:19019163-19019185 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1093449119 12:19295734-19295756 TGGTTGTAAGATAGAGAAGAAGG + Intronic
1094189850 12:27687155-27687177 CATCTGGAAGAGAGAGAAACAGG + Intronic
1094808453 12:34113262-34113284 CACTTGCAAAACAGAGAAGCAGG - Intergenic
1095652208 12:44624778-44624800 AAGTTAGAAGACAGAGAAGCAGG - Intronic
1096240424 12:49956853-49956875 CAGTGGTAGGAGCCAGAAGCAGG - Exonic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1097374048 12:58819290-58819312 CTGTTGGCTGAGAGAGAAGCTGG - Intergenic
1097608833 12:61791149-61791171 CAGTTGTAGGAGAATGAAACTGG + Intronic
1097886718 12:64736306-64736328 CAGTTCTAGGAGAGAGAACCAGG + Intronic
1099242942 12:80160041-80160063 CACATGTAAGAGAAAGAAACTGG + Intergenic
1100167544 12:91934054-91934076 CTGTTGTAAGAGTTAGAAGAAGG - Intergenic
1100286687 12:93173502-93173524 AAGAGGTAAGAGAGAGAAGGGGG + Intergenic
1100909841 12:99346793-99346815 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1101367795 12:104091436-104091458 AAGATGTAAGACAGAAAAGCTGG - Intronic
1101429307 12:104613571-104613593 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1101494271 12:105238595-105238617 CAGGAGTAAGAGAGAAAGGCAGG + Intronic
1101503810 12:105328860-105328882 CACTTGTAAGAGACAGAAAATGG - Intronic
1101629830 12:106482496-106482518 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
1102746212 12:115251231-115251253 CAGTTATAAGGGAGAGAGGGAGG + Intergenic
1103326404 12:120124015-120124037 CCGTCGTGAGAGAGAGAGGCCGG - Intergenic
1103376052 12:120456938-120456960 CTGTTCAAAGATAGAGAAGCTGG - Intronic
1103453867 12:121049522-121049544 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1104666544 12:130651233-130651255 CAGGTGTGAGAGAGATCAGCGGG + Intronic
1105031691 12:132888306-132888328 CGGTTTTAAGAGGGTGAAGCAGG + Intronic
1105890330 13:24677994-24678016 CAGATGTAGAATAGAGAAGCAGG - Intergenic
1107034868 13:35891273-35891295 CAGTTGACAGAGAGCCAAGCTGG + Intronic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107726891 13:43308026-43308048 CAGCAGTGAGAGAGGGAAGCAGG - Intronic
1108044841 13:46373926-46373948 CAATTGGAAGAGGGAAAAGCAGG - Intronic
1109003230 13:56834549-56834571 CAGGAGTAAGATAGAGAATCGGG + Intergenic
1109219689 13:59628753-59628775 CATTTGTAGGGGAGAGGAGCAGG + Intergenic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109491189 13:63101659-63101681 CAAGGGTAAGAGAGAGAAGCGGG - Intergenic
1111115559 13:83772746-83772768 CAGCAGGAAGAGAGAGAATCAGG + Intergenic
1111476838 13:88761081-88761103 CAGTTGGAAGAGGGCCAAGCAGG + Intergenic
1111515907 13:89330608-89330630 CAGCAGCAAGAGAGAGAAGGAGG + Intergenic
1111656513 13:91160921-91160943 CAGGAGGAAGAGAGAGAAGCAGG - Intergenic
1112851691 13:103713930-103713952 ACGTTGAAAAAGAGAGAAGCTGG + Intergenic
1113134553 13:107075130-107075152 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1113344616 13:109464946-109464968 CAGCTGTCAGAAAGAGAATCTGG + Intergenic
1113369853 13:109713861-109713883 CAGGAGGAAGAGAGTGAAGCGGG + Intergenic
1114731073 14:24993428-24993450 CAATGGCAAGAAAGAGAAGCGGG - Intronic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1114824344 14:26058724-26058746 CTGTTGTTAGAAAGAGAAGGGGG + Intergenic
1114965356 14:27952955-27952977 CAGTTGTAAGTTGGAGATGCAGG + Intergenic
1115097601 14:29656510-29656532 AAGTTGTAAGAGCAAAAAGCAGG + Intronic
1115464171 14:33696316-33696338 CAGTTGGCAGAGACAGAACCAGG - Intronic
1116211702 14:41954613-41954635 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1116507184 14:45698588-45698610 CAGAAGCAAGAGAGAGAAGAGGG - Intergenic
1117268981 14:54121724-54121746 AAGTTGTTATAGAGACAAGCAGG - Intergenic
1117428205 14:55623128-55623150 CGGTTGTAAGAAAGAATAGCAGG - Intronic
1117823205 14:59673028-59673050 AAGTTGAAAAAGAGAGAAACAGG - Intronic
1118181778 14:63501071-63501093 CACTTGTAAGAGGGAGAGCCAGG + Intronic
1118602235 14:67478900-67478922 TAGTGGTAAGAGAAAAAAGCAGG + Intronic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1118732849 14:68681361-68681383 AAGATGTAAGAGAGAGGAGGAGG + Intronic
1120360093 14:83488947-83488969 CATTTGTAATAGTGAGAAGCTGG + Intergenic
1120547166 14:85826387-85826409 CAGTTGAAATAGAGACAAGGAGG + Intergenic
1120886313 14:89454539-89454561 CATTTGTAACAGAGAAAAACTGG + Intronic
1120886316 14:89454580-89454602 CACTTGTAAAAGAGAAAAACCGG + Intronic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1122386787 14:101353925-101353947 CAGCTAGAAGAGAGAGGAGCTGG - Intergenic
1124347981 15:28935058-28935080 TTGTTGTAAGAGAAAAAAGCAGG + Intronic
1124445111 15:29723388-29723410 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1125173453 15:36793210-36793232 CAGTAGTAAGGGAGACAAGCAGG - Intronic
1125409953 15:39395711-39395733 CAGGTGTGAGAGTGAGAAGAAGG + Intergenic
1127225745 15:56926620-56926642 CAGTTCAGAGAGAGAGAAGCTGG + Intronic
1127513055 15:59662493-59662515 CAGTTATAGGAGAGAGATGCTGG - Exonic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1128903869 15:71450468-71450490 AACTTGTAAGTGATAGAAGCTGG - Intronic
1129715519 15:77846342-77846364 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1129943927 15:79523049-79523071 GAGGTGTAAGAAAGAGCAGCCGG + Intergenic
1130051804 15:80490108-80490130 AAGTGGTGAGAGAGAGAAGCTGG + Intronic
1130102404 15:80903917-80903939 CAGTTCTAAGATCCAGAAGCAGG - Intronic
1130198823 15:81806607-81806629 AAGTTGTGAGAGAGAGAAAAAGG - Intergenic
1130416235 15:83697195-83697217 TAATGGGAAGAGAGAGAAGCAGG - Intronic
1130636596 15:85627330-85627352 CAGAAGTAAGAGAGAAAAACAGG - Intronic
1131669875 15:94608371-94608393 CATTTGTAAGATGGAGAACCAGG + Intergenic
1132210510 15:100018535-100018557 CAGGAGGAAGAGAGAGAAGTGGG - Intronic
1133204475 16:4224965-4224987 CGGTGGTAAGTGAAAGAAGCTGG + Intronic
1134321411 16:13167672-13167694 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1134593728 16:15477926-15477948 CAGTTGTAAGAGAGAGGACCTGG + Intronic
1134595060 16:15489450-15489472 CTGTTCTAAGAGAAAGAAGCTGG - Intronic
1134777784 16:16867922-16867944 CCTTTGTAAGAGAGAGAATGGGG - Intergenic
1134832987 16:17338389-17338411 CAGATGTAAAAGAGAGGAGCAGG - Intronic
1134887997 16:17811438-17811460 GAGTGGTAAGGAAGAGAAGCTGG + Intergenic
1135425687 16:22333626-22333648 CAGTCCTATGAGAGAGAAACAGG - Exonic
1135840089 16:25868369-25868391 AAGGGGGAAGAGAGAGAAGCAGG - Intronic
1137372913 16:47925428-47925450 CAGGTGTATGAGAGAGAGACGGG + Intergenic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137505574 16:49051361-49051383 CAGTTCTAAAGGAGAGGAGCAGG + Intergenic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1138727266 16:59153361-59153383 CACTTGGAAGAGAGCCAAGCGGG - Intergenic
1139004180 16:62551195-62551217 CGGAAGTAAGAGAAAGAAGCTGG - Intergenic
1139745781 16:69073383-69073405 CCGTTCTAAGAGAGAAACGCAGG - Intronic
1140248980 16:73277891-73277913 CAGGAGCAAGAGAGAGAGGCAGG + Intergenic
1140543964 16:75788576-75788598 CAGGAGGAAGAGAGCGAAGCGGG - Intergenic
1140940066 16:79713253-79713275 CAGTTGTAAAATAGAAAGGCTGG - Intergenic
1141086753 16:81101282-81101304 CAGCTGCAAGAGAAAGAACCAGG + Intergenic
1141176926 16:81726846-81726868 CAATTGCAAGAGACAGATGCTGG - Intergenic
1144358410 17:14468167-14468189 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1145806011 17:27730748-27730770 CAGGTGTAAGAGACAGCATCTGG + Intergenic
1147056197 17:37837044-37837066 AAGCTGTGAAAGAGAGAAGCTGG - Intergenic
1148324515 17:46775446-46775468 CAGTTGTCAGGGGGAGAGGCAGG + Intronic
1149136682 17:53374986-53375008 CAGTTGAAAGAGAGATACTCAGG + Intergenic
1149324078 17:55511974-55511996 CAGTGATAAGACAGAGAAGCAGG + Intergenic
1149406546 17:56357507-56357529 CAGTAGAAAGGGAGAGATGCAGG - Intronic
1150541104 17:66100119-66100141 GAGTTGTACAAGAGAGAGGCTGG + Intronic
1150628881 17:66862357-66862379 CACTTGTAAGTGACACAAGCTGG - Intronic
1150947238 17:69761286-69761308 GAGGTGTTAGATAGAGAAGCAGG - Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151550526 17:74820131-74820153 TGGTTGTATGAGAAAGAAGCTGG - Intronic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152365976 17:79856580-79856602 CAGTTTTAGAAGATAGAAGCTGG + Intergenic
1152840330 17:82563408-82563430 CAGCGAGAAGAGAGAGAAGCAGG + Exonic
1153612342 18:6899234-6899256 TAGTTGTAAGGGAGAGTACCTGG - Intronic
1154067977 18:11127051-11127073 TAGTTGGAGGAGAGAGAAGGAGG + Intronic
1154085174 18:11297645-11297667 CTGTTCTAGGAGAGAGAACCTGG - Intergenic
1155113539 18:22739951-22739973 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1157769699 18:50334982-50335004 TAGGAGTAAGAGAGAGAAGGGGG - Intergenic
1157965251 18:52201664-52201686 CAGTTATAAGAGAGATTTGCCGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1158904917 18:62002438-62002460 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1159066942 18:63580619-63580641 TATTAGTAAGAAAGAGAAGCAGG + Intergenic
1159505841 18:69334015-69334037 CAGGAGTAAGAGAGAGAAAGAGG - Intergenic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1163884017 19:19950166-19950188 CTGTTGTTGGAGAGAGGAGCTGG - Intergenic
1164820007 19:31242631-31242653 CAGTTCTACGAGAGAGAACCTGG + Intergenic
1164820017 19:31242751-31242773 CAGTTCTAACAGAGAGAACCTGG + Intergenic
1164820024 19:31242811-31242833 CAGTTCTAGGAGAGAGAACCTGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1167575678 19:50316368-50316390 CAGATGTAGGAGGGAGGAGCAGG + Intronic
1168059302 19:53882423-53882445 CAGGTGGAAGGGAGAGGAGCTGG - Exonic
1168640543 19:58028810-58028832 CAGGTGGAAGATGGAGAAGCTGG + Intergenic
925248030 2:2402187-2402209 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
925677365 2:6378184-6378206 CAGATGTAGGAGAGTGAAACTGG + Intergenic
926003226 2:9351217-9351239 CACTTGAAAAAGAGAGAAGGAGG + Intronic
926537396 2:14129842-14129864 CATTTGTAAAAAATAGAAGCAGG + Intergenic
927232252 2:20835056-20835078 CACTTGTAAGAGTCAGAAGAAGG + Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927485031 2:23482723-23482745 CTGTTGTAAGAGAGAGAGACAGG - Intronic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
928140182 2:28721816-28721838 GAGTTGGAAAACAGAGAAGCTGG - Intergenic
928575992 2:32655593-32655615 CATTGGTATGAGTGAGAAGCTGG - Intronic
929790966 2:45022606-45022628 AAGCAGTGAGAGAGAGAAGCAGG - Intergenic
929902140 2:46014352-46014374 TAGTTGTAAGAGGGAGGACCTGG - Intronic
930081909 2:47457472-47457494 CAGGAGCAAGAGAGAGAAGGGGG + Intronic
930935027 2:56938543-56938565 ATGTTGCAAGAGAAAGAAGCAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
936397480 2:112140463-112140485 CAGTTTTCAGAGAGAGGTGCAGG + Intronic
936638519 2:114286552-114286574 CAGGAGCAAGAGAGAGAAGTGGG + Intergenic
937330625 2:121026067-121026089 CAGCTGTAACACAGAGAAGTGGG + Intergenic
937395834 2:121533950-121533972 CTTTTGTAAAAGAGAGAAGAGGG + Intronic
938170808 2:129074463-129074485 CCATTCTAGGAGAGAGAAGCTGG - Intergenic
938179490 2:129167313-129167335 CAGGTGAGAGAGAAAGAAGCAGG - Intergenic
938600046 2:132828435-132828457 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
938615802 2:132997036-132997058 CCTTAGTAAGAGGGAGAAGCTGG - Intronic
938901022 2:135798495-135798517 CAGTGGTGAGAAAGAGAACCGGG - Intronic
939437450 2:142196737-142196759 AAGTTCAAAGAGAGAGAAGTTGG - Intergenic
939687314 2:145215141-145215163 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
939692045 2:145275473-145275495 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
939978423 2:148748177-148748199 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
940472638 2:154117783-154117805 CACATGTAAGAGAAAGAAACTGG + Intronic
942172191 2:173299345-173299367 CAGATGTTAGAAAGAGAAGTTGG + Intergenic
942314535 2:174685283-174685305 AAATTGGAAGGGAGAGAAGCAGG - Intergenic
943519573 2:188931574-188931596 GTGTTGTAAGAGAGAGAACCTGG + Intergenic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
944755271 2:202755045-202755067 CAGGAGCAAGAGAGAGAAGTGGG + Intronic
945239736 2:207665551-207665573 CAGTAGCAAGAGAGAGAAAGGGG - Intergenic
945584412 2:211640682-211640704 AAGTTGTAAGATAGATAAGCAGG + Intronic
945631434 2:212282886-212282908 CATTTGTAAAAGAGAGAAACTGG - Intronic
946435226 2:219647230-219647252 CAGGGGTAAGAGAGAGAGGGGGG - Intergenic
946744892 2:222835861-222835883 CAGCTTTAGTAGAGAGAAGCTGG + Intergenic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
947126472 2:226874017-226874039 CAGGTGTAAGAGAGAGCACAGGG + Intronic
947936381 2:234008347-234008369 CAGCTGAAAGAAAGAGAAGAGGG - Intronic
948115179 2:235490159-235490181 CAGGTGTAAGAGAGAGAGAGAGG - Intergenic
948288239 2:236803852-236803874 CAGAGGTCAGAGAGAGAGGCAGG + Intergenic
948658728 2:239493347-239493369 CAGAAGGAAGAGAGAGAAGGAGG + Intergenic
949077519 2:242070574-242070596 CAGCTGAAAGAGTGAGAAGCAGG - Intergenic
1169650991 20:7866999-7867021 CAGGTGTTAGAGAGAGATGCTGG + Intergenic
1170098744 20:12675455-12675477 CAGTGGGAGGAGAGACAAGCAGG + Intergenic
1170164211 20:13345083-13345105 CAGTTTTAAGAGGCAGAATCAGG - Intergenic
1170273585 20:14556246-14556268 TAGTTATAAGGGAGAGAACCCGG - Intronic
1170323522 20:15129677-15129699 CAGTCGTAAGAGAGAGCAAAGGG - Intronic
1170488075 20:16840495-16840517 CAGTCCTAGAAGAGAGAAGCTGG + Intergenic
1171144698 20:22771422-22771444 CATTTGCAAAAGAGAGGAGCTGG + Intergenic
1172345376 20:34194185-34194207 CAGTGCTGAGAGAGAGAACCAGG + Intergenic
1172716856 20:36970756-36970778 CATTTGGAAGAGGGAGAAGTGGG + Intergenic
1173034700 20:39397283-39397305 CAGTTGTAAGAGAAATGAACCGG + Intergenic
1174668166 20:52280322-52280344 AAATTGTAAGAGAGAGAACCGGG + Intergenic
1174925126 20:54750788-54750810 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1174935382 20:54862084-54862106 CTGTTGTCATAGAGAGGAGCTGG + Intergenic
1176122692 20:63461341-63461363 TAATTGTAAAGGAGAGAAGCCGG + Intronic
1176335807 21:5598343-5598365 CACATGTAAAAGAGTGAAGCTGG + Intergenic
1176391950 21:6222605-6222627 CACATGTAAAAGAGTGAAGCTGG - Intergenic
1176469469 21:7093569-7093591 CACATGTAAAAGAGTGAAGCTGG + Intergenic
1176493030 21:7475347-7475369 CACATGTAAAAGAGTGAAGCTGG + Intergenic
1176507612 21:7663036-7663058 CACATGTAAAAGAGTGAAGCTGG - Intergenic
1176924339 21:14729016-14729038 TAGTTGTGACAGAGAGAATCTGG - Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1179239838 21:39580336-39580358 CAGGTAGAAGAGAGAGAAGGGGG - Intronic
1179332986 21:40423565-40423587 CACTTGGAAGAGACTGAAGCAGG - Intronic
1179598733 21:42461395-42461417 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1179893076 21:44347101-44347123 CAGGAGTAAGAGAGAGAGACAGG + Intergenic
1180454987 22:15506802-15506824 CACTTGCAAAACAGAGAAGCAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
949717780 3:6953237-6953259 CAGTTAGAAGACAGAGAAGAGGG + Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950533430 3:13566310-13566332 CACTCGTACAAGAGAGAAGCAGG - Intronic
952208078 3:31200435-31200457 CAGTTTTAAGTGGGAGAAGGAGG - Intergenic
952548230 3:34446211-34446233 CAGAAGTAAGAGAGAGAAAAGGG - Intergenic
952779632 3:37083058-37083080 CAGTTGTCAGAGAGCAAATCTGG + Intronic
953318602 3:41951640-41951662 CACATGTAAAAGAGAGAAGTTGG + Intronic
953745745 3:45572694-45572716 CAGTTGTAAGAGGGTCAAGCAGG - Intronic
953784793 3:45903265-45903287 CAATTGCAGTAGAGAGAAGCAGG - Intronic
953828236 3:46272664-46272686 CACTTGTGGGAGAGAGGAGCGGG - Intergenic
953968412 3:47328066-47328088 CAGTAGTAAGAAAAACAAGCTGG + Intronic
954615471 3:51967039-51967061 CAGGAGTCAGAGAGAGGAGCAGG + Intronic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
955466112 3:59238775-59238797 CAGCTGGAAGAGAGTGAAACTGG - Intergenic
955611866 3:60766041-60766063 AAATTGAGAGAGAGAGAAGCTGG - Intronic
955651312 3:61196992-61197014 CATTTAGAAGAGAGAGGAGCTGG + Intronic
956368372 3:68531372-68531394 CACTTGAAAGAGGGACAAGCGGG + Intronic
956775098 3:72558446-72558468 CAGGAGCAAGAGAGAGAGGCAGG - Intergenic
956803418 3:72784937-72784959 CATTTCTAAGAAAGTGAAGCTGG - Intronic
956815754 3:72906847-72906869 CAGTTGTGAGAGATACAAGTAGG + Intronic
956901830 3:73724761-73724783 CAGGAGCAAGAGAGAGAAGTGGG + Intergenic
957428943 3:80076637-80076659 CAGTTGGAAGAGGGCCAAGCAGG - Intergenic
959021760 3:101195231-101195253 CAGAAGAAAGAGAGTGAAGCGGG + Intergenic
959193910 3:103152359-103152381 AAGTTGTTGGAGAGAGAAACTGG - Intergenic
959712948 3:109402958-109402980 TGTGTGTAAGAGAGAGAAGCAGG + Intergenic
959858742 3:111192375-111192397 CAGTTCAAAGAAAGAGAAGTTGG + Intronic
960451034 3:117808456-117808478 TAGTTGTAATAGGGAAAAGCTGG - Intergenic
960913563 3:122674548-122674570 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
963596892 3:147339392-147339414 CATTTTTAGGAGAGAGAAGGGGG + Intergenic
963680877 3:148374967-148374989 CAGTTAGATGAAAGAGAAGCAGG + Intergenic
964064851 3:152564783-152564805 CATTAGTAAGAGAGAGATGAAGG - Intergenic
964334441 3:155639914-155639936 CAGGAGGAAGAAAGAGAAGCTGG - Intronic
964539008 3:157758172-157758194 CAGTTGTTAAAGAGAAAACCAGG + Intergenic
964629138 3:158790617-158790639 CAGGTGTAAGAAAGAGAACAAGG + Intronic
964667015 3:159185827-159185849 GAGCTCTAAGAGAGAGAACCAGG + Intronic
965619195 3:170625543-170625565 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
965807126 3:172553183-172553205 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
965883182 3:173411792-173411814 CAGATGTAACCCAGAGAAGCAGG - Intronic
966076249 3:175938687-175938709 CAGTAGGAAGAGAGAGAAAGAGG - Intergenic
966262745 3:178000166-178000188 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
967120860 3:186381623-186381645 CACTTGGAAGAGAGCCAAGCAGG - Intergenic
967676233 3:192301946-192301968 AAGGTGTAAGAGAGAAAAGATGG - Intronic
968157821 3:196397473-196397495 CAGTTGTAAAAGGGAGTAGTGGG + Intronic
969699719 4:8761504-8761526 GAGGTGGAAGAGAGAGCAGCTGG - Intergenic
970792616 4:19876535-19876557 CAGAAGCAAGACAGAGAAGCAGG + Intergenic
971005663 4:22371746-22371768 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
971088460 4:23309493-23309515 CACTTGAAAGAGGGAGATGCTGG - Intergenic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
972683897 4:41333085-41333107 CAGAAGGAAGAGAGAGAAGGGGG + Intergenic
972878713 4:43396828-43396850 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
973677434 4:53279423-53279445 CACTTTTAAGAAAGAGAAACAGG + Intronic
973927246 4:55751216-55751238 CAGTTGTAGCACAGAGAAACAGG + Intergenic
973933419 4:55817092-55817114 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
974384793 4:61190302-61190324 CATTGGCAAGAGAGAGAAGTGGG + Intergenic
975199394 4:71567894-71567916 CAGTTTTAAGAAAGACAAACAGG - Exonic
975656207 4:76643405-76643427 CAGTTATAAGACAGAGAGACAGG + Intronic
975948334 4:79736701-79736723 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
976059441 4:81109002-81109024 CATTTGTAAGAGATACATGCTGG - Intronic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
978000174 4:103547767-103547789 CAGTTGGAAGAGACCCAAGCAGG + Intergenic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
979881246 4:125962740-125962762 CAGGTGCAAGAGAGAGAGGAGGG - Intergenic
980150393 4:129040094-129040116 CGGTTGAAAGAGAGAGAAAAAGG - Intronic
980782674 4:137512043-137512065 ATGTTGTAAGAGAAAGAAGACGG + Intergenic
980879301 4:138693222-138693244 CAGGAGGAAGAGAGAGCAGCAGG - Intergenic
980993558 4:139759463-139759485 AAATTGTAAGGGAGAGATGCTGG - Intronic
981525658 4:145704877-145704899 CACTTGGAAGAGGGTGAAGCAGG + Intronic
982056142 4:151550823-151550845 CACCTGTCAGGGAGAGAAGCAGG + Intronic
982305188 4:153923268-153923290 CGGGTGCAAGAGAAAGAAGCAGG - Intergenic
982550116 4:156787190-156787212 CAGTTGAGAGAGAGAGAAGGAGG + Intronic
982666521 4:158271040-158271062 CAGGAGCAAGAGAGAGAAGTGGG - Intergenic
983267409 4:165522186-165522208 CAGGAGTAAGACAGAGAAGGGGG - Intergenic
983406315 4:167335544-167335566 CACTTGGAAGAGAGCTAAGCAGG + Intergenic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
983698255 4:170559466-170559488 CAGGAGCAAGAGAGAGAAGTGGG - Intergenic
983917834 4:173311551-173311573 CAGGAGCAAGAGAGAGAAGCAGG + Intronic
984132202 4:175891688-175891710 AAGCTGTAAGAGAGAAAAGAAGG + Intronic
984352424 4:178612876-178612898 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
986178591 5:5372973-5372995 CACTTGGAAGAGAGCCAAGCAGG + Intergenic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
986538653 5:8819579-8819601 CAGGAGGAAGAGATAGAAGCAGG - Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
987502319 5:18729214-18729236 CAGTTGAAAGAGGCAGAAGGAGG - Intergenic
987524819 5:19033687-19033709 AAGTTGTTAGAGAGGAAAGCAGG + Intergenic
988383533 5:30531262-30531284 TAATAGTAAGAGAGAGAAGGAGG - Intergenic
988440248 5:31225585-31225607 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
988753386 5:34216050-34216072 CAGTTATGAGAGTGAGAAGATGG - Intergenic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
991741168 5:69676896-69676918 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991756450 5:69877546-69877568 CAGTTATGAGAGTGAGAAGATGG + Intergenic
991792742 5:70256633-70256655 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991820628 5:70552969-70552991 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991835852 5:70753459-70753481 CAGTTATGAGAGTGAGAAGATGG + Intergenic
991885192 5:71256941-71256963 CAGTTATGAGAGTGAGAAGATGG - Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994736144 5:103558878-103558900 CAATTGAAAGAAAAAGAAGCTGG - Exonic
995477451 5:112562518-112562540 CAGGAGGAAGAGAGTGAAGCGGG - Intergenic
997068852 5:130594912-130594934 CAGGAGCAAGAGAGAGAAGGTGG - Intergenic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997779755 5:136644726-136644748 CAGCAGTAAGAGAGAGAAGGGGG - Intergenic
1000975358 5:167758423-167758445 AAGGTGGAAGAGAGAGAGGCAGG + Intronic
1001970900 5:175954194-175954216 CAGCTGTGAGGCAGAGAAGCAGG - Intronic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1002246537 5:177889571-177889593 CAGCTGTGAGGCAGAGAAGCAGG + Intergenic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1002971465 6:2026247-2026269 GAGTTTGAAGTGAGAGAAGCTGG - Intronic
1003652985 6:7978357-7978379 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1004317538 6:14603245-14603267 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1005158306 6:22833772-22833794 CACTTGGAAGAGGGACAAGCAGG - Intergenic
1005551554 6:26922871-26922893 CAGTTATGAGAGTGAGAAGATGG - Intergenic
1005665191 6:28045613-28045635 CATTTGTAATAGAAAGAACCAGG + Intergenic
1006096169 6:31658133-31658155 GAGTTGTTGGAGGGAGAAGCTGG + Exonic
1006199716 6:32277162-32277184 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1007496626 6:42264444-42264466 CAGGAGGCAGAGAGAGAAGCTGG + Intronic
1007634381 6:43289245-43289267 CAGTTCTAAAGTAGAGAAGCAGG - Intergenic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1008333471 6:50271399-50271421 CAGTAGAAAGAAACAGAAGCAGG - Intergenic
1008754551 6:54778546-54778568 CAGGAGGAAGAGAGAGAAGCGGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009618130 6:66037595-66037617 CAGTTGCAAAAGAGAGAAGTGGG + Intergenic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1011903049 6:92324966-92324988 CAGCAGTAAGGGAGAGATGCAGG - Intergenic
1012779336 6:103536775-103536797 CACTTGGAAGAGGGCGAAGCGGG + Intergenic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1017447447 6:154519989-154520011 CAGATGTTAAAGAGAGAAGGAGG - Intergenic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1017907414 6:158766710-158766732 CAGTTGTAATAGTGCCAAGCAGG - Exonic
1018351217 6:162961310-162961332 CAGTTGCAAGTGAGACAATCAGG - Intronic
1019554638 7:1622788-1622810 AAGTTAGAAGAGTGAGAAGCAGG + Intergenic
1019768285 7:2867084-2867106 CAGGAGTGAGAGAGAGAAGGGGG + Intergenic
1019975052 7:4574459-4574481 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1020045190 7:5035349-5035371 CAGATGTCAGCGTGAGAAGCAGG + Intronic
1020890884 7:13876563-13876585 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1020978952 7:15044093-15044115 CAGTTGGAAGAGAGCCAATCGGG + Intergenic
1021292678 7:18865383-18865405 GAGTGGTAAAAGAGAGAAGGGGG + Intronic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1021801063 7:24306752-24306774 CAGATGAGATAGAGAGAAGCTGG + Intergenic
1021833508 7:24643078-24643100 CAGTTGTAGAAGAGAGATGTGGG + Intronic
1022247145 7:28571354-28571376 CAGTTACAAGAAGGAGAAGCAGG - Intronic
1022622198 7:31996135-31996157 AAGTTGAGAGAGAGAGAAGCTGG + Intronic
1023333720 7:39146573-39146595 CAGTTTAGAGAGAGAAAAGCAGG + Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023825123 7:44003816-44003838 CAGATGTCAGTGTGAGAAGCAGG - Intronic
1024066786 7:45744224-45744246 GAGAAGCAAGAGAGAGAAGCGGG + Intergenic
1024234803 7:47389891-47389913 AAGTTGTATGAGACAGAAACGGG - Intronic
1024422979 7:49191461-49191483 CCATCCTAAGAGAGAGAAGCTGG - Intergenic
1024757290 7:52549837-52549859 TAGTTTTAAGAGGGAGGAGCTGG + Intergenic
1026004635 7:66591569-66591591 CAGTTGAGGGAGAGAGAAGGGGG - Intergenic
1026088671 7:67282598-67282620 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1026302794 7:69112377-69112399 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1026459209 7:70598679-70598701 CACTTGTCAGAAAGAGAATCTGG - Intronic
1026501907 7:70949949-70949971 CACTTGTAAGAGAGAAAATGTGG + Intergenic
1026725577 7:72867752-72867774 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026747664 7:73025616-73025638 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026751314 7:73053755-73053777 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026754963 7:73081869-73081891 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026758615 7:73109903-73109925 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027033871 7:74910910-74910932 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027088790 7:75283582-75283604 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027092433 7:75311510-75311532 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027096076 7:75339477-75339499 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027118268 7:75497901-75497923 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027273534 7:76537566-76537588 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027323263 7:77028215-77028237 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027326982 7:77056623-77056645 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027377187 7:77563180-77563202 CAGCTTTAAGTCAGAGAAGCTGG - Intronic
1028110087 7:86929864-86929886 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1028338029 7:89681856-89681878 CAGTTTTGAGAGAGGGTAGCAGG + Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1028786966 7:94806542-94806564 TAATTGCAAGAGAGAGAAGCAGG + Intergenic
1028874226 7:95802405-95802427 CAGTTGAATCAGAGAGAAGTTGG + Intronic
1029174503 7:98655038-98655060 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1029174719 7:98656446-98656468 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1029241431 7:99166010-99166032 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1029397078 7:100315748-100315770 CAGATGTCAGCGTGAGAAGCAGG - Intronic
1029719225 7:102352139-102352161 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1029753390 7:102557127-102557149 CAGATGTCAGTGTGAGAAGCAGG - Intronic
1029771339 7:102656211-102656233 CAGATGTCAGTGTGAGAAGCAGG - Intronic
1030414803 7:109229786-109229808 CAGTTGGAAGAGGGCCAAGCAGG + Intergenic
1030762132 7:113364972-113364994 AAGGAGGAAGAGAGAGAAGCGGG - Intergenic
1031360803 7:120846094-120846116 GAGGAGTAAGAGAGAGAAGGGGG + Intronic
1031549926 7:123097095-123097117 AATTTGTAAGAGAGACAAGGTGG + Intergenic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033439863 7:141368877-141368899 CAGATGTAAGGGAGCAAAGCAGG - Intronic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1033992933 7:147310208-147310230 CAGTTGTAAGAGCCAGAAAAAGG - Intronic
1035536074 8:392459-392481 CAGCTGAAAGAGTGAGAAGCAGG - Intergenic
1035664131 8:1367866-1367888 AACTGGTAAGAGAGAGAAGAGGG + Intergenic
1035931702 8:3786792-3786814 CAGGTGGTAGAGAGAGAAGAAGG + Intronic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1036700464 8:11010158-11010180 CAGGAGGAAGAGAGAGAAGCAGG + Intronic
1036950975 8:13138986-13139008 TATTTTTAAGAGAGAGAAGCTGG + Intronic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1038870063 8:31484028-31484050 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039454253 8:37697125-37697147 CAGCTGTGGGAGACAGAAGCAGG - Exonic
1039826049 8:41174941-41174963 CACTTGTAGGAGAGATAAGAGGG + Intergenic
1040646353 8:49401695-49401717 CAGGTATCAGAGAGAGCAGCTGG + Intergenic
1040713536 8:50219610-50219632 CAGGAGGAAGAGAGAGAAACGGG + Intronic
1040778281 8:51073724-51073746 CAGTTATCTGAGAGGGAAGCTGG + Intergenic
1040833660 8:51708179-51708201 AAGTTGAAAGAGAGAAAAACAGG + Intronic
1041374893 8:57203441-57203463 CAGTTGGAAGAGGGCGAAGCGGG + Intergenic
1041376057 8:57210167-57210189 CAGTTGGAAGAGGGCGAAGCGGG + Intergenic
1041861310 8:62516071-62516093 CACTTGGAAGAGAGCCAAGCTGG + Intronic
1044093404 8:88030497-88030519 TTATTGTCAGAGAGAGAAGCTGG - Intergenic
1044307634 8:90656414-90656436 TAGTTGCTAGACAGAGAAGCTGG - Intronic
1044565290 8:93655970-93655992 AAGTTGCAAGTGAGAGAAACAGG - Intergenic
1044770899 8:95632819-95632841 CACATGCAAGAGAGAGAAGGGGG + Intergenic
1044783141 8:95763975-95763997 CAGCTGCAAGTGTGAGAAGCAGG + Intergenic
1045270372 8:100656247-100656269 CACTTGGAAGAGGGACAAGCAGG - Intronic
1046521976 8:115336526-115336548 CAGTTGTAATGGGGTGAAGCTGG + Intergenic
1046735021 8:117767706-117767728 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1047937870 8:129799741-129799763 CAGGAGGAAGAGAGAGAAGGAGG + Intergenic
1048432044 8:134379478-134379500 CAGTTGGAAGAGGGCCAAGCGGG - Intergenic
1048710120 8:137200629-137200651 TAGTAGTAAGTGAGAGAAGAAGG + Intergenic
1048844407 8:138593442-138593464 CAGATGTGAGAGAGAGAGGAAGG - Intronic
1051663855 9:19450077-19450099 CAGTTGTTAAAGTGAGAAGGTGG + Intronic
1051969531 9:22871438-22871460 TAGTTGTAAGAGGGAGAATATGG - Intergenic
1055262574 9:74455088-74455110 CAGTTATAAGAGTGAGTAGAGGG + Intergenic
1055530129 9:77176287-77176309 TAGCTGAATGAGAGAGAAGCAGG + Intergenic
1055712681 9:79081599-79081621 CAGATGAAACAGAGAGAAGGGGG + Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056232653 9:84562599-84562621 GAGTTTTAAGAGAGAAATGCAGG + Intergenic
1056714719 9:89019915-89019937 CGGTTTTCAGGGAGAGAAGCTGG + Intronic
1057181628 9:93033798-93033820 CAGCTGTAAGTCAGAGCAGCTGG - Intronic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1058847326 9:108974088-108974110 CACGTGTAAGAGAGGGAGGCAGG + Intronic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059744119 9:117183767-117183789 CAGATGTAATAGAGTGAGGCTGG - Intronic
1059855525 9:118393070-118393092 CAGGAGCAAGAGAGAGAAGGAGG - Intergenic
1060257582 9:122046281-122046303 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1061183377 9:129037798-129037820 CAGTTGTAGCAGGCAGAAGCTGG + Intronic
1203425832 Un_GL000195v1:36559-36581 CACATGTAAAAGAGTGAAGCTGG - Intergenic
1186179883 X:6963185-6963207 CAGCTGGAAGAAAGAGTAGCAGG + Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186453849 X:9695205-9695227 CAGTTGCAAGAGAGACCAGATGG + Intronic
1186673773 X:11794284-11794306 CACTAGTAAGAGAGAGAGGAGGG - Intergenic
1187735909 X:22303514-22303536 CATTACCAAGAGAGAGAAGCAGG + Intergenic
1188305935 X:28559750-28559772 CAGGTGAGAGAGAGAGAAGGAGG + Intergenic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188816875 X:34726209-34726231 CACTTGTAAGAGAGAAAATGCGG + Intergenic
1188953575 X:36407261-36407283 AAGTTGTAAGAGGGAGAACCTGG - Intergenic
1189628964 X:42931603-42931625 CAGAAGAAAGAGAGAGAAGGGGG + Intergenic
1189927662 X:45973501-45973523 CAGCTGTAAGAATGAGGAGCGGG - Intergenic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1190787577 X:53666636-53666658 CACTGGTAAGAGAGGTAAGCAGG - Intronic
1191801915 X:65090931-65090953 CAGGAGCAAGAGAGAGACGCAGG - Intergenic
1192579975 X:72272902-72272924 CAGTTGCAAGACACAGATGCTGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193558284 X:82984299-82984321 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1193965269 X:87976837-87976859 CAGGAGAAAGAGAGAGAAGTGGG - Intergenic
1194064049 X:89240505-89240527 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1194170627 X:90576032-90576054 CACTTGGAAGAGAGTCAAGCAGG + Intergenic
1195659324 X:107362629-107362651 AAATTTTAAGAGAGGGAAGCGGG - Intergenic
1195789761 X:108570881-108570903 CAGTAGTGAGTGAGAAAAGCTGG + Intronic
1196562352 X:117165513-117165535 CAGTTGAAAGTGAGAAGAGCAGG + Intergenic
1197289510 X:124638163-124638185 CATCTGGAAGAGAGAGAAGGAGG + Intronic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1200048992 X:153418519-153418541 GAGTTGTAAGACAGAAAAACAGG - Intronic
1200516869 Y:4153792-4153814 CACTTGGAAGAGAGTCAAGCAGG + Intergenic
1200718224 Y:6574604-6574626 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1201489046 Y:14522409-14522431 CAGCTGTAACAGAGAGATCCTGG - Intergenic
1201550494 Y:15212315-15212337 AAGTTGCAAGAGAGAGAGGGAGG + Intergenic
1201628215 Y:16038973-16038995 CAGGAGTAAGAGAGAAAAGGGGG + Intergenic